![Microbiology Fundamentals: A Clinical Approach](https://www.bartleby.com/isbn_cover_images/9781259709227/9781259709227_largeCoverImage.gif)
Concept explainers
(i)
To create:
The frame shift mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT
Introduction:
The mutation which occurs in introns is insertion or deletion. It can cause shift in open reading frame of the gene sequence, and can change the amino acid sequence of the coded protein.
(i)
![Check Mark](/static/check-mark.png)
Explanation of Solution
Change in the genetic sequence of DNA, by addition and deletion of nucleotides, results in gene mutation.
Insertion mutation: This mutation occurs by insertion of one or more nucleotides in the DNA sequence. Insertion mutation is a type of frame shift mutation, as insertion of a single
Original DNA sequence:
Frame shift due to insertion mutation:
Deletion mutation: This mutation occurs due to removal of one or more nucleotides from DNA sequence. Deletion mutation is a type of frame shift mutation, as removal of a single nucleotide shifts the whole reading frame in the DNA.
Original DNA sequence:
Frame shift due to deletion mutation:
(ii)
To create:
The silent mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT
Introduction:
The mutations in the codons that do not change the particular amino acid in the given polypeptide chain are called synonymous mutations. They are also called silent mutations because they cause no change in the structure of the protein.
(ii)
![Check Mark](/static/check-mark.png)
Explanation of Solution
Silent mutation involves base substitution which results in same amino acids that was encoded by previous nucleotidal sequence.
Original DNA sequence:
Corresponding RNA sequence:
Amino acid sequence: Tyrosine Glutamine Methionine Histidine Serine Proline
Silent mutation:
Corresponding RNA sequence:
Amino acid sequence: Tyrosine Glutamine Methionine Histidine Serine Proline
(iii)
To create:
The nonsense mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT
Introduction:
The nonsense mutations are the mutations that generate the stop codon. The generated stop codon terminates the translational process and thus, the protein structure will not be formed because no more amino acids will be added to the sequence.
(iii)
![Check Mark](/static/check-mark.png)
Explanation of Solution
Nonsense mutation involves substitution of a single base pair that yields a stop codon.
Original DNA sequence:
Nonsense mutation:
Corresponding RNA sequence:
Want to see more full solutions like this?
Chapter 8 Solutions
Microbiology Fundamentals: A Clinical Approach
- If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’arrow_forwardThe letters ABCDEFGH represent a normal DNA sequence. Indicate the type of mutation present in each of the following situations: a) ABCCDEFGH b) ABCDEGHarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forward
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.arrow_forwardA certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibilityarrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)arrow_forward
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?arrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forward
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Glarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Glyarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Proarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)