Question 13 Listen The closer two genes are together on a chromosome, the fewer recombinants are found between them a) True b) False
Q: Identify the true statements regarding disulfide bri Disulfide bridges are formed by an irreversibl…
A: Disulphide bridge is a covalent bond formed between two sulphur atoms of cysteine residues present…
Q: Many pharmaceuticals exert their action by inhibiting the activity of enzymes. Choose the false…
A: Enzyme inhibition occurs when certain substances, called inhibitors bind to and inactivate enzymes.…
Q: Genetics Question 12
A: The objective of the question is to identify the stage of cell division during which crossing over…
Q: Identify 2 independent helices domains Identify a disordered region In the structure, box the…
A: Proteins are essential molecules that perform many important functions in cells. They are made up of…
Q: draw the structure of the peptide Asp - Asn-Ser-Lys-Pro at PH 8
A: The given peptide is Asp - Asn-Ser-Lys-Pro.Asp is aspartic acid which is an acidic amino acid with…
Q: What is the energy charge for the cell with concentrations of [ATP] = 1.000 mM, [ADP] = 10.00 uM,…
A: The energy charge, EC of a cell can be calculated using the formulaEC = [ATP + (1/2 ADP) ] / (ATP…
Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…
A: The objective of the question is to determine the length of the Sh protein in amino acids (AA's)…
Q: In your opinion, what is the most harmful effect of widespread opioid use? Why is opioid different…
A: A class of medications known as opioids is derived from or imitates natural chemicals present in the…
Q: GQ 1
A: The question is asking for the probability that all four offspring of a long-haired cat and a…
Q: 4. Which amino acids do not react to produce a purple color with ninhydrin. Why?
A: Biological macromolecules are the molecules that are needed in a sufficient quantity for the…
Q: Rate in U [S] in mM No Inhibitor 0.5 1.0 2.0 4.0 8.0 16.0 32.0 64.0 0.22 0.41 0.73 1.12 1.57 2.01…
A: The Michaelis-Menten kinetics is the simplest and best model to understand enzyme kinetics, and it…
Q: addition to L-lactate, which of the following molecules is (are) generated by fermentation of…
A: Fermentation is an anaerobic process that occurs in the absence of oxygen, leading to the conversion…
Q: Please discuss the buffering capacity of an amino acid. In your answer include what is a buffer? Why…
A: Amino acids are organic compounds that serve as the building blocks of proteins. They have three…
Q: Question 1: The standard reduction potential for the the cytochrome c Fe3+/Fe2+ redox couple and for…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: If non-disjunction occurs at meiosis 2 in a male, 2 of the 4 sperm formed in that meiosis will have…
A: Non-disjunction can happen in meiosis 1 or meiosis 2.Non-disjunction is said to have taken place in…
Q: 2. a) Energetics of the electron transport. In the oxidative phase of oxidative phosphorylation,…
A: Standard change in Gibbs free energy ( ) of redox reactions can be determined , if we know the…
Q: 3. The image below depicts 2,3-bisphosphoglycerate depicted in dark gray, and ß subunits are…
A: The objective of the question is to understand the role of 2,3-bisphosphoglycerate (BPG) in the…
Q: When the CAC is run in reverse by microorganisms that use it to fix carbon, the citrate synthase…
A: Kreb cycle is the reaction procews that operates in the mitochondria and it is followed by…
Q: EXAMPLE:Label the tonicity of the solution outside the cell, where Outside Inside Outside Inside are…
A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…
Q: 23. Calculate the free energy of hydrolysis ATP in a rat liver cell in which the ATP, ADP, and Pi…
A: The objective of this question is to calculate the free energy of hydrolysis of ATP in a rat liver…
Q: 5. What is the binuclear center of cytochrome oxidase? How does it function in the reduction of O₂?
A: The binuclear center of cytochrome oxidase is the active site of this key enzyme in the electron…
Q: Molecule A held promise as a treatment for rheumatoid arthritis except that it remained in the body…
A: Many factors determine the duration of time a drug stays in the body. The drug being hydrophobic…
Q: Question 10 Listen Donna is heterozygous for both hemophilia (a sex linked recessive trait) and…
A: The objective of this question is to determine the probability of Donna and Michael's sons…
Q: imagine that you are running a sample on a TLC plate that is comprised of aspartate and isoleucine.…
A: The working principle of thin-layer chromatography is the same as column chromatography.A small…
Q: Genetics Question 8
A: The objective of the question is to identify the correct event that occurs during the prophase of…
Q: Consider a buffer solution of acetate. The volume is 500 ml, the concentration is 200 mM, and the pH…
A: a) Total moles = volume in L × concentration (M)Volume in L = 0.5 LConcentration = 200 mM = 0.2…
Q: 5. Explain the difference between a centriole and a centromere
A: The objective of this question is to understand the difference between two key components of a cell:…
Q: Use the appropriate equation to calculate the free energy change for the movement of Nat into the…
A: The Nernst equation, named after Walther Nernst, is a powerful tool in electrochemistry that relates…
Q: 1. Amino Acid 1 = W + X = 1 Draw amino acid 1 at a low pH a) As the D Fisher Projection Name of…
A: The Fischer D/L configuration is set with respect to the configuration of glyceraldehyde.>Here…
Q: The data in the table are used to create a calibration curve for the determination of RNA from ts…
A: The 'least square method' is an alternate name for the linear regression model of statistical…
Q: Use the scoring system described to calculate the alignment score for IPNIA A IG D V VAG P VKGIYA V…
A: The alignment score is the sum of individual matches when two or more DNA or protein sequences are…
Q: Choose all of the completely correct statements describing peptide X below: 00. 00 HO. O €0 NH3 O:…
A: Proteases are the protein digesting enzymes which cleave peptide bonds. There are some proteases…
Q: Directions: Answer the following as directed: vinu oto de 00 200nsko2 brs 2nA lo epello 1. After…
A: Amino acids are building blocks of proteins, which have three different chemical groups: an amino…
Q: What is the molecular weight of the molecule that gets eluted from the column at 10 ml?
A: The given graph shows a linear relationship between the elution volume (ml) on x axis and IgM…
Q: What is full name of the N-terminal amino acid residue? Just type the name (one word). What is the…
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They are monomers or…
Q: Describe the amino acid composition in terms of the general characteristics and comment on what the…
A: Proteins are made up of around 20 standard and a few non-standard amino acids. Depending on the…
Q: Suppose a yeast enzyme performs this reaction: Glyceraldehyde 3 - phophospate (GAP or G3P) → 3- -…
A: Glycolysis is the metabolic pathway where glucose is catabolised into pyruvate with a net production…
Q: Finally, the researcher incubates the peptide with chymotrypsin for two hours at 10 °C and analyzes…
A: Peptide digestion refers to the process of breakdown of peptide primary structure for different…
Q: What further experiments are needed to provide confidence that the structural data obtained from the…
A: SCAM analysis predicts whether an amino acid in a transmembrane protein is within the membrane,…
Q: 4nM 10 μΜ Ο 0.01 nM Ο Ο Ο 2 nM -2 nM
A: A Hill Plot is a type of graphical representation used in pharmacology and biochemistry to show how…
Q: The enzyme that catalyzes the formation of the peptide bond is located: in the large ribosomal…
A: During translation amino acids get linked to each other via peptide bonds. The enzyme responsible…
Q: What is the number of possible linear oligopeptides with 4 polar uncharged amino acid residues?
A: The objective of this question is to determine the number of possible linear oligopeptides that can…
Q: Please fill in the four boxes bolded below you KM (MM) Vmax (nM/s) Type of inhibition…
A: Competitive inhibitors are the substances which are similar to substrate molecules in their…
Q: provide an example of internal myopia, external myopia, and normative myopia in health care,…
A: Myopia is an eye condition where light from far-off objects focuses in front of the retina rather…
Q: Describe the important biochemical properties of carbohydrates and why carbohydrates would be…
A: Carbohydrates are essential biomolecules that serve as the primary source of energy for living…
Q: Why do you see a sharp decline in this graph at pHs higher and lower than 6? Effect of pH on Enzyme…
A: The graph shows how pH affects the activity of the enzymes. Enzyme activity is displayed on the…
Q: What are the biological actions of enzymes ? What reactions do they catalyze? please include…
A: 1. Overview of Enzymes: Since they catalyze chemical reactions in living things without being…
Q: What is the amino acid most similar to the structure below? Just type the name (one word). H3C Se…
A:
Q: Using BME will disrupt which structures of a protein consisting of a single chain? Secondary,…
A: A protein is a large biological molecule made up of amino acid residues linked together by peptide…
Q: You find a vial of clear, unknown sample in the freezer of your lab. The easiest way to determine…
A: We have to find the easiest way to determine the presence of proteins in a sample vial.The given…
Genetics Question 13
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Question 45 Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I. A True B) FalseQUESTION 11 "Waxy endosperm (wx), virescent seedling (v), and shrunken endosperm (sh) are all recessive mutants in corn. Waxy and shrunken are both on chromosome 9, located 18 map units apart. Virescent is on chromosome 5 and is not linked to the other loci. A strain of corn that is homozygous for waxy and virescent is crossed to a strain that is homozygous for shrunken endosperm. The F1 were entirely wild type. An F1 individual was then test crossed to a strain that is homozygous for waxy, virescent and shrunken. Of 1000 offspring, how many of the offspring will be virescent and shrunken, but not waxy?" 205 430 230 215 200Question 17 What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3 A 5'-UAGUGACAGUUGCGAU-3' B 5-TAGCGTTGACAGTGATA-3 5'-ATCACTGTCAACGCTA-3 D 5'-TAGTGACAGTTGCGAT-3'
- QUESTION 7 After you graduate, you are working at a laboratory that identifies a novel protein called Leprechaun. To determine in which organelles Leprechaun is found, you decide to express the Leprechaun gene in HeLa cells using a plasmid. Since you have generated an antibody that recognizes an epitope within the Leprechaun protein, which technique will you use to identify its localization within the HeLa cells? OA. SDS-PAGE O B. Immunocytochemistry O C. Western blot OD. Transmission electron microscopy (TEM) OE. Immunohistochemistry QUESTION 8 Which of the following statements regarding electron microscopy is TRUE? OA. White light is utilized to illuminate the sample for imaging in all types of electron microscopy. OB. Electrons pass through the object being examined in transmission electron microscopy (TEM). OC. In scanning electron microscopy (SEM) electrons, electrons bounce off the surface of the sample. OD. Electron microscopy can be used to view structures as small as 2 nm in…Question 4 In order to replicate both strands of DNA SIMULTANEOUSLY, E. coli bacteria folds or loops one strand so both strands can do 5' to 3' synthesis. (A True B FalseQuestion 14 Friedreich's ataxia is a rare inherited disease that causes nervous system damage and movement problems. It usually begins in childhood and leads to impaired muscle coordination (ataxia) that worsens over time. Friedreich's ataxia is caused by an insertion of several copies of a three nucleotide sequence in a gene called FXN. Which genetic testing method would be most appropriate for testing for Freidreich's ataxia? O PCR with gel electrophoresis O PCR with conventional sequencing O PCR with SNP-chip O PCR with whole-genome sequencing
- Question 23 Both pseudogenes and orthologous genes are duplicated in the genome of the same species. Paralogous genes are gene duplication that acquire new/specialized function. The 1st statement is True and the 2nd statement is False. O The 1st statement is False and the 2nd statement is True. O Both Staments are True. O Both statements are False.Question 15 Only eukaryotic transcription enzymes will synthesize small nuclear RNA molecules involved in the maturation and processing of other RNAS. (A) True B) FalseQUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.
- QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…QUESTION 17 Twelve recessive proline auxotrophs in Neurospora were isolated in a mutant screen. These mutants do not grow on minimal medium. Pairwise crosses were performed and the diploid F1 were tested for growth on minimal medium. The table below shows the result of these crosses, where (+) indicates growth and (-) indicates no growth on minimal medium. 1 4 6 7 8. 9 10 11 12 1 + (C-1) + 3 4 (C-II) 6 8 9 10 11 12 How many different genes were identified in this mutant screen? gene(s) List the mutants defective in each gene. (Use "-" to link mutants in the same gene, use "," to separate each gene. For example: 1-2, 3-4, 5-6-7) Fill in the gray squares of the table with the expected result. Indicating a (+) for growth and a (-) if no growth. C-I C-II ++++ +++Question 22 Cloning vector contains a multiple cloning site (MCS) or polylinker containing multiple unique restriction sites. It also contains markers that allow for rapid selection of colonies with insert-containing plasmids in them. The 1st statement is True and the 2nd statement is False. The 1st statement is False and the 2nd statement is True. O Both Staments are True. O Both statements are False.