Erythromycin, an antibiotic discovered in 1952 from soil bacterium Saccharopolyspora erythraea, was discovered by a Filipino scientist Abelardo Aguilar. Enumerate the important considerations before the drug was put on commercial scale
Q: Identify the parts and the function of each parts of Pyrococcus furiosus and Salmonella typhimurium.…
A: Prokaryotes include Archaea and Bacteria, which are two different types of microorganisms. Archaea:…
Q: ndospores : A. are a dormant form of a bacterium AND are formed by members of medically relevant…
A: Endospores are pathogens and remain viable for years. The endospores are resistant to heat and…
Q: 1. Which materials are to be prepared when using Spread Plate technique for bacterial isolation from…
A: Spread Plate technique This technique is used for the isolation and enumeration of microorganisms in…
Q: samples and trying to determine characteristics they contain. You determine sample M requires an…
A: On the basis of Habitat in which the microorganism live, these can be classified into many types.…
Q: Which of the following groups of archaea have useful roles in various applications of recombinant…
A: There are three domains of life archaea bacteria and eukaryotes. Archaea are specialised for living…
Q: A microbiologist is working with a pure strain of bacteria isolated from a mixed sample. Which of…
A: Streptococcus mutans is a bacteria which is often found in the oral cavity of human. It is a…
Q: This is a figure from a recent paper comparing different bacterial pathogen strains. What is being…
A: Pathogens are microbes that cause disease in host.
Q: It is the period wherein the bacteria is sensitive to radiation and antimicrobial agents. Question…
A: Often bacterial growth involves different phases in its life cycle. These different phases are very…
Q: Which of the following is FALSE about interpreting the results of normal microbial flora experiment?…
A: Beta hemolysis is complete hemolysis . It is characterized by a clear zone surrounding the colonies.…
Q: "If you find purple colonies with metallic green sheen growing on your EMB plate following an…
A: Introduction : Gram-negative bacteria can be identified using the selective stain Eosin-Methylene…
Q: One of the following is considered as Fastidious bacteria: Select one: Staphylococcus spp.…
A: Bacteria are usually single-celled microorganisms that can be present everywhere. They are…
Q: In terms of drug development, rank the following microbes from most difficult (1) to least difficult…
A: Drug development is the process of bringing a new pharmaceutical drug to the market once a lead…
Q: Erythromycin, an antibiotic discovered in 1952 from soil bacterium Saccharopolyspora erythraea, was…
A: Microbiology is the branch of biology that deals with study of organisms that are too small to be…
Q: Citing data from the results table, tell which antibiotic is most effective against this type of…
A: Antibiotic zone of inhibition Antibiotics are a class of compounds or chemical that inhibits the…
Q: Which microbe do you think would be least isolated from an air sample? A. Clostridium perfringens…
A: Different sorts of bacteria, viruses, fungi, protozoa etc. can be isolated from air samples.
Q: Identify the best taxonomic category that best describes the prokaryote in the given scenario. An…
A: Prokaryotes and Eukaryotes: Living organisms are classified into prokaryotes and eukaryotes based on…
Q: A microbe is growing on Sabouraud dextrose agar, which has a slightly acidic pH. Which of the…
A: A culture medium contains enough nutrients for the growth of targeted or desired microbe. Different…
Q: In this activity, you will receive an “unknown” containing two species. The first step in…
A: For identifying unknown samples ,Microbiology students perform a step by step experiments and…
Q: Gram-negative nitrogen-fixing bacteria found in association with plant roots are deeply…
A: Alphaproteobacteria. (Rhizobium)
Q: Which of the following is FALSE about interpreting the results of normal microbial flora experiment?…
A: From shortly after birth until death, every human being's skin and mucous membranes are home to a…
Q: Ti plasmid carrying a foreign gene is inserted into which bacterium that infects a plant cell? a.…
A: The Ti plasmid vector is used in the world of plant genetic engineering with the aim of introducing…
Q: discuss how the bacterium Agrobacterium tumefaciens normally functions. Please also discuss how this…
A: Bacteria are a group of prokaryotic microscopic single celled organisms. They live in diverse…
Q: Which of the following statements BEST represents the great plate count anomaly? a The aggregation…
A: A bacterial or microbial culture is the process by which microbes are allowed to multiply in a…
Q: Complete the table: Bacterium Shape of cell Arrangement of cells Other important cell feature…
A: All the above mentioned organisms are bacteria.
Q: What are some characteristics of Clostridium difficile that contribute to the pathogenicity of this…
A: Bacteria are microscopic organisms which belong to prokaryote because these are unicellular…
Q: (a) You received three cultures (Escherichia coli, Saccharomyces cereviciae, and Rhizopus oryzae)…
A: PCR is used to amplify a target DNA.When boiling method and Gene releaser were used then the…
Q: The following will prevent the growth of bacteria: Keeping food at room temperatureKeeping food…
A: Introduction Bacteria Are Single-celled Organisms That Do Not Belong To Either The Plant Or Animal…
Q: When counting bacteria, the difference between the standard plate (STP) count and a direct…
A: Direct microscopic count It is quantitative method. It is used to estimate the actual number of…
Q: Citing the data from your results table tell which antibiotic is the most effective against this…
A: Antibiotic Sensitivity Test is a test used to evaluate to efficacy of particular antibiotic in…
Q: Many species of bacteria live bound together by a gluelike substance that, among other things, makes…
A: The dental plaque in human teeth is treatable but if it isn't removed when it soft, then it can…
Q: Write a paragraph for when you once have Neisseria gonorrhoea bacteria in its pure form, what…
A: Neisseria gonorrhoeae that are also termed gonococcus or gonococci, are defined as a species of…
Q: A medium was inoculated with 5 * 106 cells/ml of Escherichiacoli cells. Following a 1-h lag, the…
A: Growth curves are generally the description of the density of cell populations in liquid culture…
Q: Which one of the following microorganisms would you use as a quality control check to ensure that…
A: Answer: STERILIZATION TECHNIQUES = These are the techniques which we uses in laboratories in order…
Q: Which of the following is not an acid fast bacterium: A. Mycobacterium tuberculosis B.…
A: Acid-fast bacteria stain red after acid-fast staining due to the existence of their cell wall.…
Q: Briefly describe the abiogenesis belief and one experiment to disprove it that was not always…
A: As per our policy, we are answering the first question only. For the rest of the questions, kindly…
Q: A stool specimen of a patient with severe diarrhea was cultured in a series of specialized media for…
A: E. coli is part of the normal flora of the human intestines.
Q: discuss which two rooms in your home or workplace that you believe are the most contaminated.…
A: Microorganisms are microscopic in nature and can be categorized into bacteria, virus, fungi, algae,…
Q: A colony of spherical bacteria which are in a cluster are classified as: Question 26 options:…
A: Introduction: Bacterial cells might be discovered arranged differently or existing on their own. The…
Q: A microbiologist identifies a bacterium that is capable of degrading cellulose, lignin, chitin,…
A: There are several bacteria present which can degrade several waste material and convert them into…
Q: In a series of infection experiments, a researcher discovers that the ID50 value for the infectious…
A: Answer Parasiticum mucoides
Q: You work for the U.S Department of Agriculture's Agricultural Marketing Services, which is…
A: Standard plate count method is a technique which is used by microbiologists which allows them to…
Q: In a series of infection experiments, a researcher discovers that the ID50 value for the infectious…
A: Microbes such as most bacteria and most fungi are heterotrophic in nature. They are not capable of…
Q: What statement describes the danger of using heavy metals to control microbe growth? Group of answer…
A: Heavy metals kill microbes by binding to proteins, thus inhibiting enzymatic activity.
Q: attached Microbiology question AND ANSWER THE QUESTION COMPLETELY. Thank you. *If you actually…
A: Answer
Q: Identify the genus that best fits each of the following descriptions: a. This organism can produce a…
A: Introduction: Those living beings that cannot be visualized without the use of instruments are…
Q: You are tasked with quantifying bacteria in your soil sample. You resuspend 1.0g of soil in 10 ml 1x…
A: Given data:Number of colonies = 175Volume plated = 150 uLTube dilution = 10^-4 or Dilution factor =…
Q: An imaginary bacteria has the following ID50 for each portal of entry: Skin: 300 endospores Lungs:…
A: Most bacteria can enter the body through one route and get established to cause infection and…
Q: In the early part of this century, tropical medicine expert Dr. Richard P. Strong obtained…
A: Bioethics Ethics in the field of medicine and its application is called bioethics. Autonomy is…
Q: What is the best explanation for why a bacteriostatic treatment might be chosen over a bacteriocidal…
A: Microbiology is the branch of science that deals with the study of microorganisms that are too small…
- Erythromycin, an antibiotic discovered in 1952 from soil bacterium Saccharopolyspora erythraea, was discovered by a Filipino scientist Abelardo Aguilar.
- Enumerate the important considerations before the drug was put on commercial scale
Step by step
Solved in 2 steps
- write an introduction of 3000 words with the project title, sulfamethoxazole-trimethoprim:impact on plant microbiome and resistomes.1. Write briefly about Metabolism of drugs ( just 5 lines ) 2. Write briefly about Polyethylene glycol ( just 3 lines ) 3. The levigating agent , explain about its role in Suppositories manufacturing 4. Write in details about types of gel 5. Write in details about fusion method in ointment preparationkindly do a research review of related study about alcohol-based hand sanitizer with an extract from calamansi rinds, focusing on its antibacterial properties. also, strictly follow to the rrs format (using words such as 'according to', 'in a study entitled', and etc.) and cite the reference.
- discuss the misuse of antibacterial drugs in depth and the affect this issue is having on society. Also discuss how this has led to the development of “superbugs”.in terms of drug development, rank the following microbes from most difficult (1) to least difficult (3): helminths fungi bacteriaAs an Environmental Engineer, a local health project requires you to use the Koch’s postulate to establish and ascertain the causative organism for the disease Tuberculosis in a given population. Provide a systematic and chronological blueprint of your plan to achieve this purpose.
- Many antibiotics used in modern medicine are compounds made by fungi that inhibit bacterial protein synthesis. Describe the specific effect of the following antimicrobial drugs: (i) Chloramphenicol (ii) RifamycinSome bacteria produce the enzyme penicillinase, which breaks the beta-lactam ring in the penicillin molecule and converts it into penicilloic acid, which is harmless to bacteria. This is an example of which of the following mechanisms of antibiotic resistance? which option below is the answer? Destruction or inactivation of the antibiotic by the microbe Preventing penetration to the target site within the microbe Alteration of the drug’s target site(s) within the microbe None of the other four answers are correct Rapid ejection (pumping) of the drug out of the microbial cellIn paragraph form (about 2-3 long paragraphs), discuss how to isolate and purify antimicrobial agents from root samples. Preferably using an extraction technique. Please discuss everything in detail and provide the DOI of the journal you sourced so I can cross-check it.
- According to USP Chapter <797>, allergenic extract preparation can be made in a doctor’s office facility by trained personnel only if the allergenic extract preparation: a)Is compounded under a laminar air flow hood Is compounded by a pharmacist b)Contains an antimicrobial preservative c)Is used immediately after preparation d)Is prepared only from plant origin materialIn terms of drug development, rank the following microbes from most difficult (1) to least difficult (3): Group of answer choices helminths fungi bacteriaThis is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids