Identify the best taxonomic category that best describes the prokaryote in the given scenario. An isolated bacteria smear was subjected to Gram staining and showed a pink color. Group of answer choices Gram-positive Gram-negative Psychrophile Methanogen
Q: If all the channels in the membrane were open, what would happen to the length and time constants? O...
A: Answer is option A i.e. length and time constant will decrease. Explanation: As all channels will be...
Q: 21. The binding of aspartate to different subunits of ATPase is an example of a. Negative cooperativ...
A: Introduction :- A homotropic allosteric modulator is both a substrate and a regulatory molecule for ...
Q: Neurons and macroglia are similar in that they develop from _______, whereas microglia develop from ...
A: The nervous system is made up of neurons, specialized cells that can receive and transmit chemical o...
Q: elicited by the Coronavirus. Instruction: Differentiate the two: Antigen vs Immunogen. 1. What ...
A: Answer :: Antigen vs immunogen 1) The CO stands for corona, VI for virus, and D for disease. Forme...
Q: Adult chimpanzees actively teach and guide offspring in learning tool use behaviors. True or False
A: The answer is True .
Q: Chromosomes are visible under microscope during cell division because a. Thickening of chromatins b....
A: Correct option is a.Thickening of chromatins The nucleoli vanish, and the chromatin fibres thicke...
Q: select the correct options: A) For organisms that diverged >74 mya, ignore 3rd base positions with...
A: Phylogenetic In biology, phylogenetic is the study evolutionary history and relationships between d...
Q: Question 3. An abnormally high levels intracellular tangles are observed to occur in the brains of p...
A: Neurofibrillary tangles are unusual gatherings of a protein that gather inside neurons. The healthy ...
Q: In snapdragons, flower color shows incomplete dominance. Plant height (tall or short) is a standard...
A: Introduction: Incomplete dominance is a form of intermediate inheritance in which one allele for a s...
Q: A study of microbial pathogen transport in an aqueous environment is to be studied. The target micro...
A: In normal case, E. coli is normally found in the intestinal tract of human and animals. It is an fac...
Q: Rhesus factor is a protein found onlthe surface of the red blood cells. Having Rhesus factor (Rh+) i...
A:
Q: (c) State the main function of the following:
A: Tissue is a gathering of cells that have similar design and that work all together. A nonliving mate...
Q: Some organisms have features that have different functions, but similar structures. One example is t...
A: Evolution can be outlined as the variation that occur in the heritable traits of a biological popula...
Q: If there are 32 sister chromatieds in a normal somatic cell, what is the haploid number for that cel...
A: Chromosome are the string like structure that comprises of DNA , histone proteins as well as heredit...
Q: (A B) D Biodiversity Biodiversity
A: In the beyond twenty years, countless examinations have explored the connection among biodiversity a...
Q: abels 1. Excitation of musele cell 2. Excitation-contraction couupling 3. Crossbridge cycling Action...
A: 1b Action potential travels along sarcolemma, down wall of T-tubule 1c Calcium released from SR into...
Q: If it were possible for there to be a hybrid between a human and a chimpanzee the offspring would ha...
A: Higher level animals are generally diploid in nature, that is, they carry two copies of chromosomes ...
Q: What is the best description of tRNA (transfer RNA)? Question 15 options: It temporarily stores...
A: Transfer RNA is a short RNA molecule that aids in the production of proteins. A trinucleotide region...
Q: The theory of kin selection (inclusive fitness) takes into account that an organism can pass on copi...
A: Theory of kin selection states that an organism will favor the reproduction of close relatives over ...
Q: Label all the visible parts of this cross-section of the Hibiscus rosa-sinensis stem. Give an approp...
A:
Q: Describe the function of these molecules that help control the cell cycle A.) M-phase promoting fact...
A: A) Maturation promoting factor is a cell cycle gatekeeper that controls a cell's transition from the...
Q: In corn, kernel color is governed by a dominant allele for white color (W) and by a recessive allele...
A: the Hardy-Weinberg equilibrium states that genetic variation in a population will remain constant fr...
Q: In a tabular form, compare the different biomes based on specific criteria. Follow the table format...
A: A biome is a defined area that is characterized by its flora, fauna, and climate.
Q: Green plants absorb sunlight to power photosynthesis, the chemical synthesis of food from water and ...
A: Photosynthesis is the process in which green plants make their own food by using sunlight, water, an...
Q: Which category of classification has the largest variety of organisms? Group of answer choices class...
A: Classification is a way in taxonomy to classify organisms depending upon their charechterstics. Cla...
Q: Mitosis differs from meiosis in that only mitosis: O is preceded by interphase involves two successi...
A: Introduction: Cell division is the means of reproduction in which all cells need to copy their chrom...
Q: 15. Final Synthesis. Describe how a cell that is FIXED can be used to estimate the time spent in the...
A: "Microbes on the Move" includes a personal narrative story as well as a few other short stories abou...
Q: 21. The binding of aspartate to different subunits of ATPase is an example of a. Negative cooperativ...
A: The activity of allosteric proteins/enzymes is explained by two prominent models. Monod, Wyman, and ...
Q: Define each of the following terms with regard to their energy and carbon source: a. Photoautotroph...
A: Autotrophs or primary producers are organisms that prepare their own food using light,water,carbon d...
Q: Which of the organisms in each category (A, B, C, D, and E) are not of the same species? Discuss how...
A: Due to the extreme cold, many animals are unable to stay active and outside during the winter. Adapt...
Q: What best describes the hind leg bones seen in the whale? Leg bone Analogous structures to the fins ...
A: Evolution is a steady phenomenon that brings about the transformation of simple life into complex li...
Q: Transfer of immunoglobulins from mother to child during breastfeeding can protect the child from dis...
A: Answer Naturally acquired passive immunity
Q: A childhood infection with the viral disease mumps could provide which sort of immunity? Group of an...
A: A childhood infection with the viral disease mumps could provide which sort of immunity? Ans : Natu...
Q: 2. An experiment was conducted to explore the effects of fatigue on the performance of a simple manu...
A: a) u0 (mu): For the population of all college male students, it is the population mean of the differ...
Q: Keystone Species Microbiome Diversity Plant Diversity
A: The foundation(establishment) (1) or misfortune (loss) (2) of a cornerstone animal varieties (number...
Q: In a series of infection experiments, a researcher discovers that the ID50 value for the infectious ...
A: Answer Parasiticum mucoides
Q: what kind of mutation will happen? Show t
A:
Q: What are the limitations of the quadrat approach
A:
Q: What is the probability of having a boy and at least a girl?
A: probability is defined as the number of desired outcomes divided by the total number of outcomes tha...
Q: Which of the following is NOT an intermediate filament? A. keratin B. titan C. nuclear l...
A: Intermediate filaments:- Intermediate filaments are very stable structures that form the true skelet...
Q: Within the flippase family is the flippase protein that works in the golgi and the scramblase protei...
A: * Flippase and scramblase are main enzymes that can change the phospholipid positions in cell membra...
Q: Which of the following terms refers to changes during developments to serve a specific function? O d...
A: Introduction :- Morphogenesis is a biological process that controls the spatial distribution of cell...
Q: Studying the diversity of month species in two forests calculates H' = 1.6 for forest 1 and H' = 1.1...
A: The Earth is inhabited by a variety of organisms. All organisms are classified into different phylum...
Q: H°G 1. Plant Cell 2. Animal Cell
A: Eukaryotic cells, like plants and animals, have membrane-bound structures like the mitochondrion.Pla...
Q: antibiotics
A: Microbes are organisms that are too small to be seen without using a microscope, so they include thi...
Q: Organize your thoughts about Darwin’s ideas of evolution by filling out the concept map below.
A: The filled concept map attached below.
Q: Animals attract mates through a variety of behaviors. Diurnal animals tend to rely on visual cues, w...
A: How Might Chemicals Disrupt the Endocrine System? Interruption of the endocrine framework can happen...
Q: Deodorant Phenyl will not kill which microorganism? O A. Plesiomonas O B. Treponema O C. Klebsiella ...
A: The deodorant phenyl is designed to kill bacteria (usually odor-making bacteria) as well as provide ...
Q: 2. Examine the phylogeny below, which is the phylogeny for all extant species from a genus of birds,...
A: Phylogeny for extant species refers to the evolution history of a group of species that are living a...
Q: Describe at least three to five other limiting factors (other than the number of predators or prey) ...
A: Describe at least three to five other limiting factors (other than the number of predators or prey) ...
Step by step
Solved in 3 steps
- Give typing answer with explanation and conclusion Which of the following are groups of microbes? Select all correct answers. Group of answer choices Bacteria Archaea Chromosomes Fungi Antibodies Viruses Protozoa PlantsYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTComplete the sentences with the matching vocabulary term Terms: -lytic -gram negative -aerotolerant anaerobe -ether -facultative aerobe -enveloped virus -prion -peptidoglycan -pseudopeptidoglycan -chemo heterotroph -obligate intracellular parasite -facultative anaerobe -lysogenic • A ______ bacterium will have a thin cell wall covered with an internal membrane. • A pathogen that cannot survive outside the host cell is a(n) _____. • An aerobic organism that can switch to anaerobic respiration when necessary is known as a(n) ______. • The bacterial cell wall is made of ______. • A phage that kills the host cell after one round of viral replication is referred to as a _____ phage.
- RECOVERED UNSAVED FILE This is a recovered file that is temporarily stored on your computer. Save Mark all statements that are consistent or accurate with the topic provided. Choosing more or less than the correct options will be considered incorrect. Accurate statements related to 2. 1. Functions of glycocalyx: * peptidoglycan: * Peptidoglycan is only present in gram- positive bacteria. Allows bacterium to stick to host cells. Forms pseudopodia for faster mobility of Peptidoglycan is found mainly in the cell walls of fungi and algae. an organism. Gram-negative cell wall has relatively thinner layer of peptidoglycan than gram- "Hides" the bacteria from host immune cells. positive. 3. Mismatched pairs: * Mitochondria : ATP production Golgi apparatus : Protein synthesis Vacuoles : Photosynthesis 2:03 pm P Type here to search A O G 4) ENG 29/09/2021Drag and drop the labels into the correct empty boxes to complete the concept map. source of Inspection staining transport medium microbes medium Inflammation streak plating Identification multiplication Isolation in a sterile such as Inoculation H + Hol promotes Specimen collection from a carried to the lab in a to obtain a specimen containing a single species biochemical tests Both macroscopically and microscopically via Incubation subculturing 1 using ↓ genetic analysis and immunologic testsYou must write up your OWN dichotomous key for all the possible unknown organisms listed below . The first step of the key will be the Gram Stain. Subsequent steps will include biochemical tests only. Solve the identity of an unknown bacterial specimen by creating a dichotomous key and using the staining, culturing and biochemical identification procedures . Possible Organisms Alcaligenes faecalis Enterobacter aerogenes Enterococcus faecalis Escherichia coli Proteus vulgaris Pseudomonas aeruginosa Salmonella arizoniae Staphylococcus aureus Staphylococcus epidermidis Staphylococcus saprophyticus Streptococcusbovis Streptococcus pyogenes Imp Note - the test should be performed using any of the following tests stated below. Bile Escalin test, Oxidaze test, Blood Agar , Catalese Test, Mannitol salt agar . Thank you !
- The below photograph shows a Gram-stained slide viewed using a light microscope set at brightfield of a clinical sample from a patient with symptoms suggesting an infection. The slide was viewed with x100 objective. What could be the most likely cause of infection? Gram positive bacteria, either rods or cocci Gram positive rod shaped bacteria or yeast Gram negative rod or cocci shaped bacteria Gram negative bacteria, either rods or cocciMatch the expected result (purple, red, or colorless) to the following descriptions of Gram-stained cells.Consult your chart at the beginning of this lab report if you need help remembering the correct Gramreaction for each species. Choices may be used more than once. Escherichia coli under the microscope if you forgot to apply decolorizerYou must find up your OWN dichotomous key for all the possible unknown organisms listed below. The first step of the key will be the Gram Stain. Subsequent steps will include biochemical tests only. Solve the identity of an unknown bacterial specimen by creating a dichotomous key and using the staining, culturing and biochemical identification procedures . Possible Organisms Alcaligenes faecalis Enterobacter aerogenes Enterococcus faecalis Escherichia coli Proteus vulgaris Pseudomonas aeruginosa Salmonella arizoniae Staphylococcus aureus Staphylococcus epidermidis Staphylococcus saprophyticus Streptococcusbovis Streptococcus pyogenes Note : The test must be performed using any of this test Mannitol Salt Agar, DNAse test, Catalase test, coagulase test, Novobiocin Test, BILE ESCULIN AGAR (BEA) TEST, Oxidase test, Bacitracin Sensitivity, Blood Agar . Macconkey, Nitrate Reduction test. Thank you so much in Advance !
- Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is one experiment you could do, involving culturing the organism?Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is a procedure you could do, involving making a slide of the organism?Bacteria are described as being either Gram positive or Gram negative. Elaborate on this statement, including in your answer:- the principle of the staining technique used to arrive at this classification; how the organisms are further distinguished from each other on staining; and how the information garnered from the staining may be utilized in patient care,