1. What is the isoelectric point of tyrosine? Draw out the different structures of tyrosine at each pka.
Q: Q5. Each ionizable group of an amino acid can exist in one of two states, charged or neutral. The…
A: Amino acids are simply an alpha-carbon bonded to 4 groups. The 4 groups are;an alpha-carboxyl group…
Q: 2. Match the following molecules with the-corresponding test reagents that are used to identify…
A: Biochemical tests are very important in the field of biology and biochemistry. These tests are used…
Q: Name the protein structural element shown in yellow in the figure:
A: Proteins can be defined as large biomolecules. They comprise of one or more chains of amino acids.…
Q: To track cell growth and utilization of the limiting substrate in a bioreactor, the yield is…
A: S=Y(X0−S0)X−X0+S0Explanation:Lag Phase: The growth rate is zero (μ = 0) since there is no…
Q: Please draw out mechanism The formation of fructose 1, 6- biphophste from dihydroxyacetome phospahte…
A: Glycolysis:The metabolic process known as glycolysis, which in most organisms takes place in the…
Q: Create a concept map to demonstrate the relationships between carbohydrate, protein and lipid…
A: Catabolism is the breakdown of large molecules into smaller ones. This is often undertaken to…
Q: Provide a stepwise, arrow-pushing mechanism for the following transformation. You may use general…
A: The reaction in question involves a lysis reaction catalyzed by a lyase enzyme using the coenzyme…
Q: What is full name of the N-terminal amino acid residue? Just type the name (one word). What is the…
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They are monomers or…
Q: Cooperativity yields a sigmoidal kinetic curve. Which of the following is TRUE?
A: Co-operativity can be described as a phenomenon where the enzyme shape changes with the substrate…
Q: Suppose a yeast enzyme performs this reaction: Glyceraldehyde 3 - phophospate (GAP or G3P) → 3- -…
A: Glycolysis is the metabolic pathway where glucose is catabolised into pyruvate with a net production…
Q: Modify the structure to show the MAJOR product that would be formed in the following reaction. HNO3,…
A: The process is electrophilic substitution.The Modified structure of the prouct is shown in the…
Q: Identify the product of the given reaction. IV I II III heat ? = III IV
A: Option (d) III is correct See solution in image Explanation:
Q: D. Explain why a protein (polypeptide chain) will assume a different 3-dimensional structure in: (1)…
A: The three-dimensional structure of a protein, also known as its native conformation, is critical for…
Q: STEM Workplace Practices Q5
A: The statement is false. Analytical methods are not assessed only once in their lifecycle for…
Q: 4. The interaction of Vitamin D3 with lipid membranes may be studied using different techniques. One…
A: A class of fat-soluble secosteroids is called vitamin D3 .Vitamin D3 is a kind of vitamin D that is…
Q: A glucose molecule with its 3rd carbon radiolabelled underwent glycolysis. Which carbon atom in the…
A: During the process of glycolysis, glucose is broken down into pyruvate and energy, producing two…
Q: When a leaf on an oak tree absorbs 15,440 photons, how many glyceraldehyde-3-phosphate molecules can…
A: Calvin cycle is also known as the C3 cycle. It is the cycle of chemical reactions where the carbon…
Q: 12. Consider a protein that can exist in two forms: folded (F) and unfolded (UF). Calculate the free…
A: (i.) ΔGunfolding = 2100.30 J/mol or approximately 2.10 kJ/mol (ii.) ΔGunfolding = -5446.52 J/mol…
Q: Tt O 8. What are the driving forces that promotes tertiary -3D and quaternary -4D structure…
A: Proteins are the biological macromolecules. They show great diversity in their structure and…
Q: 25. The AG" values for the two reactions are given. 1. 2. oxaloacetate + acetyl-CoA + H₂O → citrate…
A: The objective of the question is to determine the ΔG°' for the hydrolysis of Acetyl-CoA. This can be…
Q: When 10 micrograms of an enzyme with a molecular mass of 80,000 Daultons (grams/mol) is added to a…
A: Before going into the calculations for finding the turnover number (kcat), we need to convert…
Q: Part D Tubes 1 weight w/o water graph 25 3 4 5 61718 9 1.065g 1.073g 1.072 1.082 1.090g|1.105 g.…
A: Pipetting is a fundamental technique in biochemistry used for the accurate and precise transfer of…
Q: Genetics Question 20
A: The objective of this question is to determine the correct order of genes on a chromosome map based…
Q: Blood plasma contains a total carbonate pool (essentially HCO3 and CO₂(d)) of 2.5 x 10-2 M. What…
A: In order to solve this problem, first we need to calculate the initial concentrations of bicarbonate…
Q: Provide a detailed chemical mechanism for the enzymatic reaction below, and note any similarities to…
A: The reaction in question is a transketolase catalyzed reaction, where the top 2-carbon group from a…
Q: Q1
A: The objective of this question is to identify and explain three key differences between DNA…
Q: Consider the following compounds. Sablabla CH3 H₂C H₂C CH3 2 3 Use the numbers shown to answer the…
A: Organic reactions can be defined as the reactions in which organic reactants react with each other…
Q: Molecule A held promise as a treatment for rheumatoid arthritis except that it remained in the body…
A: Many factors determine the duration of time a drug stays in the body. The drug being hydrophobic…
Q: Since two 19S regulatory subunits and a 20S catalytic unit constitute the 26S proteasome, why is the…
A: A peptide is a short chain of amino acid residues linked together via peptide bonds. A folded…
Q: Cellulose contains___ linkages that ___ be digested by animals. a β1--> 4 glycosidic ; canNOT b…
A: Cellulose is a polymer of units. It is used by plants and some microbes as a means of mechanical…
Q: 7. Why proteins prefer to have a-helices or ẞ-sheets in their interior core, instead of random coil…
A: The preference for alpha helices and beta sheets in the interior core of proteins is driven by a…
Q: The Michaelis-Menten equation models the hyperbolic relationship between [S] and the initial…
A: Those proteins or biological catalysts which help to speed up the chemical reaction are termed…
Q: 1. Amino Acid 1 = W + X = 1 Draw amino acid 1 at a low pH a) As the D Fisher Projection Name of…
A: The Fischer D/L configuration is set with respect to the configuration of glyceraldehyde.>Here…
Q: Calculate how many moles of ATP can be made in standard conditions when 1 mole of protons flow back…
A: The principal energy unit of cells, ATP provides the energy required for a variety of cellular…
Q: what is The standard free energy change for the combined system that you wrote in the previous…
A: The standard free energy change (∆G°) of a chemical reaction is the free energy change at the…
Q: Polymer beads (resin) made of DEAE (diethylaminoethyl) cellulose are packed in an ion exchange…
A: DEAE cellulose resin had some groups which are positively charged and can bind proteins through…
Q: Question 1: Use this link to view Dr. Nicholson's metabolic pathways chart.…
A: Dr. Nicholson's Metabolic pathways chart is a map of an eukaryotic cell showing cellular locations…
Q: Question 6
A: The question is asking whether a mouse would die if it was injected with heat-treated S strains.…
Q: Using the information given, determine the Kd for the binding of HABA to BSA. B= y-intercept (E…
A: Y=mx+b is the equation of a line that is not passing through the origin. In this equation, m is the…
Q: Genetics Q3
A: The question is asking us to determine the percentage of Adenine (A), Guanine (G), and Cytosine (C)…
Q: Draw a mechanism to account for the inter-strand cross linkage of two guanines by busulfan. Explain…
A: Busulfan is a drug used to treat cancer. It can form inter-strand crosslinks between guanine species…
Q: You have isolated a new trisaccharide from a new species of insect shown below that you are calling…
A: Since you have posted multiple questions, we will provide the solution only to the specified sub…
Q: Consider the malate dehydrogenase reaction from the citric acid cycle. Given the listed…
A: The free energy change for the malate dehydrogenase reaction of the TCA cycle is ≈21.122…
Q: The Drug AZT is used to treat AIDS, This drug is a _____ Inhibitor/Activator of _____ a)…
A: HIV stands for human immunodeficiency virus. HIV destroys a type of white blood cells that help the…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…
A: The process of protein synthesis is also known as translation. The process of translation is…
Q: B-oxidation deals with only saturated fatty acids, but many fatty acids in natural lipids are…
A: Beta oxidation is a metabolic process in which the two carbon atoms are sequentially removed from…
Q: 2) You are studying the tripeptide Lys-Val-Thr. a) Draw the full structure of the tripeptide…
A: Pepetides are composed of amino acids. Amino acids are biomolecules where a carbon atom (called…
Q: What does it mean for fatty acids to be essential? What are the essential fatty acids?
A: Fatty acids are long-chain carboxylic acids. They are used by the body for various purposes like…
Q: • At a pH of 12, what charged groups are present in the amino acid valine? -NH3+ -CO2- -NH2- -NH3+…
A: Aminoacids are the building blocks of protein. Each aminoacid have a central carbon and it's…
Q: Explain the underlying biomechanical constructs of spring, change of direction, and agility…
A: Spring-like biomechanical constructs refer to the ability of muscles and tendons to store and…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 2 images
- 1. Consider the following α helix from myoglobin at pH 7. Gln-Gly-Ala-Met-Asn-Lys-Ala-Leu-Glu-His-Phe-Arg-Lys-Asp-Ile-Ala-Ala-Lys-Tyr(a) Label amino acids in the polypeptide above as follows: p for polar and uncharged, np for non polar, – for negatively charged, and + for positively charged.(b) How many complete turns are there in this helix?(b) Which side chains are likely to be on the side of the helix that faces the aqueous solvent? Why?(c) Which side chains are likely to face the interior of the protein? Why?6) Proteins can be modified by phosphorylation, which adds a phosphate group to the hydroxyl group of serine, threonine, or tyrosine residues. The R-group for phosphoserine is shown at right. A) The image below is an Isoelectric focusing strip that shows the unphosphorylated protein-of-interest (in blue). To which side of the unphosphorylated protein would you expect to see the phosphorylated protein? (Draw an arrow to indicate direction). Briefly justify your answer. un-phosphorylatable: Low pH Justify: B) To study the effects of phosphorylation, researchers often mutate a Ser/Thr to appear as though it is always phosphorylated or never phosphorylated at a particular site. What amino acid substitution should you use to preserve similar dimensions as Ser (or Thr) but make the side chain appear to be: constitutively (always) phosphorylated: Justify: Ser or Thr → O O=P-O O I CH₂ Ser or Thr➜ Phosphoserine High pH2. Consider the peptide Trp-Arg-Glu-Cys-Gly-Tyr. For the drawings requested below, please show in zig-zag style, from amino to carboxy terminus, with correct stereochemistry a. Draw the predominant form at pH = 2 b. Draw the predominant form at pH = 5 c. Draw the predominant form at pH = 7 d. Draw the predominant form at pH = 12
- 1. In the separation of lysine from histidine using a sulfonated polystyrene column will it be easier to separate at pH 4 or pH 8 ? explain! 2. A peptide of the order Glx-Ala-Gly-Arg bound to a sulfonated polystyrene column at neutral pH. Is Glx Glu or Gln ? Explain !1. Amino acid analysis of the peptide gave the following residues: Asp Leu Lys Met Phe Tyr. The following facts were observed: Trypsin treatment had no effect. The phenylthiohydantoin released by Edman degradation was C-C-CH2. Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The tetrapeptide contained Leu, Lys and Met is some order. Cyanogen bromide treatment afforded a dipeptide, a tetrapeptide and a free Lys. What is the amino acid sequence for this heptapeptide?For the peptide Ala-Cys-His-Ile-Leu-Asp a. Write the single letter code for the amino acid residues b. What is the charge of the peptide at pH 7.0. Assign the following pKa values: 3,4,6,8,9 c. What is the pI of the peptide
- 1. A pentapeptide has the sequence of H2N-Glu-His-Leu-Arg-Gly-COOH. a) What is the net charge of the peptide at pH 3, 8, and 11? (Use pka values for side chains and terminal amino and carboxyl groups in the table provided.) peptide. b) Estimate the pl for this pK, values Abbreviation/ symbol pk, M, (-COOH) (-NH5) (R group) pK; pKR Hydropathy Occurrence in index* proteins (%)* Amino acid pl Nonpolar, aliphatic R groups Glycine Alanine Proline Valine 2.34 -0.4 Gly G Ala A Pro P 75 9.60 5.97 7.2 89 115 2.34 9.69 10.96 6.01 6.48 5.97 1.8 1.6 4.2 3.8 4.5 7.8 5.2 1.99 117 131 Val V 2.32 2.36 9.62 9.60 6.6 9.1 Leucine Leu L 5.98 Isoleucine lle I 131 2.36 2.28 9.68 6.02 5.3 Methionine Met M 149 9.21 5.74 1.9 2.3 Aromatic R groups Phenylalanine Tyrosine Tryptophan 2.8 -1.3 3.9 3.2 Phe F 165 1.83 9.13 9.11 9.39 5.48 2.20 Tyr Y Trp W 181 10.07 5.66 204 2.38 5.89 -0.9 1.4 Polar, uncharged R groups Serine Ser S 105 2.21 6.8 9.15 9.62 5.68 5.87 5.07 5.41 5.65 -0.8 Threonine Thr T 119 2.11 -0.7 5.9…C00- *H3N -C-H CH2 он Tyrosine a. Draw the structures of tyrosine as different pH values. Please refer to the lecture notes for the pKa values b. Identify the structures that exist at pH 2 c. Solve for the plPorcine dynorphin is a neuropeptide having 17 amino acid residues. Its structure is shown below. Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln 8. How does trypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C-terminal end. 9. List down the different fragments that would result if dynorphin were cleaved by trypsin. 10. How does chymotrypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C- terminal end. 11. List down the different fragments that would result if dynorphin were cleaved by chymotrypsin. 12. Cyanogen bromide is a chemical reagent which also cleaves peptide bonds.…
- Make use of the table below in answering the questions asked: Amino acid pK₁ pK₂ pK, Isoleucine 2.32 9.76 Leucine 2.32 9.74 Lysine 2.16 9.06 10.54 Tyrosine 2.20 9.21 10.46 I 1. Make sure to answer in two decimal places. What is the pl of the tripeptide ILY? 2. At pH 9.00, at which electrode will the ILY tripeptide be moving to? A. Anode B. Cathode C. The tripeptide will not move to either electrodes Make sure to show a solution or explanation for the answer.Amino acids project from each polypeptide backbone in a β-sheet in an alternating fashion (oneabove the plane and the next below the plane – see Fig 3.8B). Consider the following proteinsequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu.a. Is there a pattern to these amino acids? If so, what is it? b. What does this sequence of amino acids mean for the hydrophobicity/hydrophilicity of theresulting β-sheet? c. Can you make a prediction about how the β-sheet will be arranged in higher levels of protein structure? If so, what prediction would you make?1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-