Biology: Science for Life with Physiology (6th Edition) (Belk, Border & Maier, The Biology: Science for Life Series, 5th Edition)
Biology: Science for Life with Physiology (6th Edition) (Belk, Border & Maier, The Biology: Science for Life Series, 5th Edition)
6th Edition
ISBN: 9780134555430
Author: Colleen Belk, Virginia Borden Maier
Publisher: PEARSON
Question
Book Icon
Chapter 10, Problem 1LTB
Summary Introduction

To write:

The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Introduction:

A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Expert Solution & Answer
Check Mark

Explanation of Solution

The process of conversion of DNA into a form of RNA (mRNA) is termed as transcription. DNA and RNA contain the same type of nitrogenous bases. However, thymine is replaced by another nitrogenous base uracil (U) in RNA.

Therefore, the RNA transcript formed from DNA with sequence CGATTACTTA is GCUAAUGAAG.

Conclusion

GCUAAUGAAG is the nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Provide the abbreviation for the amino acid sequence expected from the following mRNA segment using the three-letter amino acid codes: 5' UUUICCCIAAUIAUUIACG 3'
draw mRNA sequence for the following sequence  ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning