Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
Q: 5' UTR OP This region is specific sequence surrounding the start codon. OK OS OT 5' and 3' UTR LEU2…
A: In bacteria, there is a small circular double-stranded extra-chromsomal DNA that can replicate…
Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…
A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…
Q: Which statement best describes translation? The process converts an mRNA sequence into a…
A: The central dogma of molecular biology is a fundamental principle that describes the flow of genetic…
Q: Match the location in a cell in the first column with the process in column two. carbon dioxide is…
A: The Calvin cycle, also known as light-independent reactions, photosynthetic carbon reduction (PCR)…
Q: Identify the type of linkage found between two glucoses when they combine to form maltose. I 00000…
A: A functional group is a specific group of atoms within a molecule that is responsible for the…
Q: What is the best description of Venous circulation and arterial circulation
A: The circulatory system, a complex network of blood vessels and the heart, plays a vital role in…
Q: In the condition diabetes mellitus, why does glucose appear in the urine? Group of answer choices…
A: Hyperglycemia, or raised blood glucose levels, may be a hallmark of diabetes mellitus. Normal kidney…
Q: Volume (L) B 6 5 4 3 FEF 25-75% FEV₁ FVC
A: FEV1/FVC ratio:The FEV1/FVC ratio is a measure of how well your lungs can empty air. It is…
Q: 20. Which pair is an example of antagonistic hormones? a. Estrogen and Testosterone b. Epinephrine…
A: Hormones are specific chemical messengers that are produced and released from the endocrine glands…
Q: What happened to the left side of the bell jar when the valve was opened? O a. The intrapleural…
A: A pneumothorax is a condition where air enters the pleural space, the space between the lung and the…
Q: During the class, we examined the evolution of frog species. After the construction of a highway, at…
A: Speciation is the process by which new and distinct species evolve from a common ancestor. It is a…
Q: Which of the following most closely depicts the order of the RAS-RAF pathway in mutated cells?…
A: The RAS-RAF pathway is a signaling pathway involved in the regulation of cell growth and…
Q: What steps are taken for oxygen and by products to transport to the human body
A: The respiratory system is a crucial biological system that facilitates gas exchange within the body…
Q: What effect would a bilateral lesion to the amygdala have on a person?
A: The amygdala, a complex structure within the brain, plays a pivotal role in the processing of…
Q: In Drosophila, yellow bodies (y) and white eyes (w) are both caused by recessive X-linked alleles.…
A: Linkage is defined as the tendency of two genes to stay together during gamete formation. Linkage is…
Q: Is it true that as the sperm travels toward the secondary oocyte, the enzyme cap gets thicker so…
A: Fertilization is the process of union of two germ cells, egg and sperm, by which a new individual…
Q: Label both the h&e staining and the Masson trichrome
A: Hematoxylin and Eosin (H&E) stain and Masson’s Trichrome stain are both broadly utilized in…
Q: draw the structure of the polynucleotide GT
A:
Q: Multiple Choices: Calcium stored in the lumen of the endoplasmic reticulum is released via a…
A: It is a cell orgnelle that helps in calcium storage and protein and lipid metabolism.
Q: Intro to Neuroscience: Which of the following is an effect of cocaine and amphetamine? Group of…
A: Psychoactive drugs that affect the brain's neurotransmitter activity include cocaine and…
Q: In osmosis, water moves from an area of low solute concentration (high water concentration) to an…
A: Osmosis is the process of movement of solvents through a semipermeable membrane from a lower solute…
Q: In the MAPK pathway, GrB2 recruits _____. -GPCR -ERK1 -RTK -SOS
A: It is a signal transduction pathway used in evolution for many physiological processes such as gene…
Q: what is exercise? write an evaluation of your physical activity level. How much are you exercising…
A: In this context, investigating individual exercise propensities, comparing them to prescribed rules…
Q: Vaccination : "is an ounce of prevention worth a pound of cure?" what points can validate this…
A: The adage “an ounce of prevention is worth a pound of cure” is particularly apt when discussing…
Q: A single touch receptor can indicate the intensity of touch stimulation by the rate of action…
A: Touch receptors, also known as mechanoreceptors, are specialized sensory nerve endings that respond…
Q: Which of the following occurs as a result of a ligand binding to a Gi-coupled receptor? CAMP is…
A: Gi-coupled receptors are a type of G protein-coupled receptor (GPCR) that activates the inhibitory G…
Q: With the aid of diagrams, discuss the role of autoantibodies in three named autoimmune diseases,…
A: Autoimmune diseases are characterized by the immune system mistakenly attacking healthy tissues and…
Q: 1. What are activation energy and substrate? 2. What is specificity and active site? 3. What are…
A: In the human body, various processes happen at the same time to ensure our survival. One such…
Q: B A- E- A U D E ✓ B ✓ F- vi G- H F G D- ✓ H-
A: The image is of brain and its different parts. Brain is the most important regulatory organ of the…
Q: Which of the following facilitate chromosome separation during anaphase of mitosis? All of these…
A: Amaphase is the third stage of mitosis. In this stage the chromosome starts separating and moving…
Q: What is the BMR per square meter of the surface area for the mouse? ______ kcal/d/m2
A: Given Data:AnimalBMR (kcal/d)Mass (kg)Surface Area…
Q: Case A A 37-year-old diabetic, male visits his family physician because his joints have recently…
A: A 37-year-old male with a history of diabetes presents to his family physician with joint pain and…
Q: Draw a lipid bilayer, and focus on three lipids that are on the same side of the membrane. Color in…
A: Structure of Lipid Bilayer1. It Is made of lipids (fat) and protein molecules.2. The lipid bilayer…
Q: 2. An organism is 2n=4 with genotype AaBbEe. Genes A and B are close together on the larger…
A: Meiosis is a type of cell division. This is a reduction division, where the diploid number of…
Q: Use the diagram on the right to answer questions 1-3. 1. Which structure produces secretions that…
A: The endocrine system is an intricate system of glands and organs which generate and release hormones…
Q: Mannitol salt agar questions www microbe C microbe A microbe B 1. Which of these microbes would best…
A: The questions asked about the use of Mannitol Salt Agar (MSA) in microbiology. MSA is a selective…
Q: ● Distinguish between innate immunity and adaptive immunity. Describe the various cells and organs…
A: In this topic, we'll see the contrasts between innate and adaptive immunity, the numerous cells and…
Q: The replication cycle of the HIV.
A: Humans are infected by two kinds of lentiviruses known as human immunodeficiency viruses. They…
Q: What kinds of tool artifacts were found in the cave near Denisovan specimens? A. Lithic…
A: The question is asking about the types of tool artifacts that were discovered in the cave where…
Q: Why is washing with Hank’s balanced salt solution with 0.5% antibiotic-antimycotic done for…
A: A physiological saline solution known as Hank's balanced salt solution (HBSS) is used to keep cells'…
Q: Which enzyme is the major regulatory control point for Boxidation? a. carnitine acyl transferase I…
A: Beta oxidation is the process by which fatty acids, in the form of Acyl-CoA molecules, are broken…
Q: If the codon is 5'-GAA-3', then the corresponding anticodon is A,3'-CTT-5' B, 3'-GAA-5' C,'-GAA-3'…
A: The correspondence between codons and anticodons follows specific base-pairing rules. In RNA,…
Q: Rabies lyssavirus Characterization of etiologic agent | Life cycle or infectious cycle | Diagnosis |…
A: Rabies, a severe neurological disease, stems from the Rabies lyssavirus, a neurotropic virus…
Q: There are two (2) types of methods of estimating populations that you have learned about in this…
A: i) Estimating Populations and Appropriate Sampling Techniques:Caribou:Most Appropriate Sampling…
Q: A 69-year-old woman presents with crushing substernal chest pain and nausea. Laboratory studies show…
A: The objective of the question is to identify the pathological changes in the patient's right…
Q: What is glucose important for your body? Why is glucose especially important for the brain? Should…
A: We'll investigate the importance of glucose for the body and brain in this conversation, as well as…
Q: The pedigree shows a family with a 100% penetrance, X-linked recessive disease. What's the chance…
A: Within the case of an X-linked recessive disease, a male (XY) will show disease symptoms in the…
Q: Please fill in the blank in the picture, thank you
A: Skeletal muscles are characterized by their voluntary nature. These are striated muscles that are…
Q: video answer the following questions in your exercise book: What is the endocrine system? What is it…
A: Endocrine system, lymphatic system and the urinary system are the different physiological systems…
Q: 6. Constriction of blood vessels to the hands and the feet is most likely a response to: a.…
A: The correct answers can be identified as follows-6) b. Exposurе to cold resulting in hypothеrmia.7)…
Molecule |
Sequence |
Hb A DNA |
5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ |
Hb A mRNA |
|
Hb A protein |
|
Hb S DNA |
5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ |
Hb S mRNA |
|
Hb S protein |
transcribe and translate each sequence making the mRNA and protein sequence of each
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycineGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?thank you
- 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids expected in the final protein (using the MRNA codonstable): DNA TAC CGC TCC GCC GTC GAC AAT ACC ACT MRNA Amino Acid DNA TGA C АTG ATC MRNA AUG ACU AGC UGG GGG UAU UAC U00 UAG Amino Met Ser Trp Tyr Phe Acid DNA TAC CAC CGT ATG GCT GGG AAT ATC MRNA Amino Acidw/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
- CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out)The following is a section of a messenger RNA: 5' GACUACAUA 3' Look at the sequence carefully and using the following genetic code, translate the MRNA into an amino acid sequence. Second Letter U A G Phe uCu UC | Tyr UGU Cys u UUU U UUC UUA UUG UAU UAC UAA UAG UGC Stop UGA Stop A Stop UGG Trp G Ser UCA UCG Leu CAU CAC САА CAG CU CU His CGU U c Cuc CUA CUG Leu cc CCA CG CGC Arg CGA CG Pro Gin A 3rd G 1st letter AUU Ser u letter ACU lle ACC ACA AAU Asn AGU Thr AAC AAA A AUC AGC AUA AGA | Lys A Arg G AUG Met ACG AAG AGG Asp GUU G GUC GUA GCU GAU GAC GAA GGU GGC Gly Val |GCC GCA GCG Ala GGA GGG A Glu GUG GAG G O Tyr-Val-Val O Asp-Tyr-lle O Leu-Met-Tyr O lle-His-Gln O Asp-Thr-Leu-Tyr-Thr-His-lle 星
- Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.