Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…
A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid ) is a…
Q: 3' AAAACTGTGCAT5'
A: In order to take the needed information from DNA, cells first makes a copy of the DNA nucleotide…
Q: Briefl y describe the events in translation.
A: Translation is the process of formation of protein from the information containing in mRNA. It is…
Q: If an mRNA codon reads UAC, its complementary anticodon will bea. TUC.b. ATG.c. AUG.d. CAG
A: During translation the ribosome traverses over the mRNA in order to produce a peptide chain with the…
Q: Using the DNA template –TACTGGGTACAAGAACA- for transcription, what is the base sequence of the mRNA…
A: The genetic code is stored in the DNA, which is coded in the messenger RNAs (mRNAs) by a process…
Q: Describe the synthesis and processing of mRNAs.
A: ANSWER;- mRNA is "courier" RNA. mRNA is synthesized in the core utilizing the nucleotide arrangement…
Q: Contrast the roles of tRNA and mRNA during translation, and list all enzymes that participate in the…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part…
Q: Describe the genetic code and how the nucleotide sequence determines the amino acid and the protein…
A: Genes are the unit of hereditary which are present in a thousand of numbers on the stand of DNA…
Q: If the sequence of bases in the coding strand of a DNA molecule isTAGC, then the sequence of bases…
A: Introduction The DNA/gene give rise to the formation of mRNA by the process called gene…
Q: Explain how rRNA is processed.
A: Ribosome biogenesis or the assembly of ribosomes involves more than 200 assembly factors and spreads…
Q: Predict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’
A: mRNA is read in 5' to 3' direction. Codons are triplet i.e. a combination of three bases codes for…
Q: Explain the process of translation.
A: mRNA is used to synthesise proteins during the translation process, which occurs during the process…
Q: Discuss the genetic code, and explain how it works withdifferent types of RNA to make a protein.
A: A gene is a unit of hereditary present in thousands of numbers on the helical strands of…
Q: Explain the process of transcription, and write complementary strands through mRNA.
A: Transcription is the first several steps of DNA based on gene expression in which a particular…
Q: Explain the function of transcription and translation.
A: Gene expression is the process by which the instructions in the DNA are converted into a functional…
Q: Name and explain the process by which mRNA is formed.
A: Gene expression is the process by which information which is contained in genes is decoded to…
Q: Construct an mRNA from a gene and then translate the mRNA into a protein using the genetic code
A: mRNA is produced as a result of transcription from a gene. It is a messenger RNA which is made up of…
Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.
A: Answer
Q: Explain how the DNA code may be copied, and describe the basicfunctions of RNA.
A: The basic process of copying DNA is called DNA replication. DNA is copied and a new molecule of DNA…
Q: Describe the roles of RNA polymerase, ribosomes, andtRNA in producing a protein.
A: Ribonucleic acid (RNA) aids in the production of proteins in the body and is normally obtained from…
Q: Examine the diagram below. At which times is translation but occurring? Production of a Particular…
A: The translation of the information contained in a mRNA (messenger ribonucleic acid) into an amino…
Q: Compare transcription to translation. Which of the process is mostly related to errors?
A: Transcription vs Translation Initiation- The transcription process is the beginning of the gene…
Q: Sequence of amino acids in protein
A: Protein Synthesis: It is the process of creating protein molecules. There are 5 major steps involved…
Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…
A: The genes are the segments of DNA which carries information for the synthesis of the functional…
Q: Describe the key steps of translation
A: Translation is the process of polymerization of amino acids to form a polypeptide. The order and…
Q: Explain the process of mRNA to DNA translation
A: The second phase of protein production is translation. It happens after transcription when DNA…
Q: (c) With the indication of sense strand, template strand, the direction of transcription, provide…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: Explain the translation with its stages.
A: All cells use replication, transcription, and translation to keep track of their genetic material…
Q: If the sequence of the coding strand in a transcription unit is writtenas follows:5'…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: During which process is MRNA synthesized from a DNA template with the aid of RNA polymerase? O…
A: Introduction Genome is referred to the total amount of DNA a single haploid cell contains. Genome…
Q: Briefly describe the events in translation.
A: The translation is one of the defined processes of the cell cycle. It is the last step in fact and…
Q: Describe the process of translation and transcription.
A: By activating the enzyme RNA polymerase, the DNA strand is converted into mRNA during the…
Q: Explain the process of TRANSLATION
A: DNA is the nucleic acid that stores genetic information.
Q: Write down some function of Mrna?
A: mRNA stands for messenger RNA. The process of the formation of messenger RNA from the DNA is called…
Q: Put the function of mRNA is blank
A: Replication is the process of formation of identical copies of DNA. Transcription is the formation…
Q: Describe the relationship between the template strand of DNA, the codons inmRNA, anticodons in tRNA,…
A: Introduction:- The process of copying genetic information from one strand of DNA into RNA is termed…
Q: In details summarize the process of transcription.
A: Two questions are asked. I will answer first question, as per guidelines. Transcription The DNA…
Q: Describe the role of stop codons in the termination of protein synthesis.
A: Protein synthesis is a biological mechanism that occurs within cells to compensate for the loss of…
Q: Identify the features of tRNA that are important in decoding genetic information and converting it…
A: Codons encode specific amino acids for protein synthesis, a process known as translation. Transfer…
Q: If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1
A: A triplet codon is where each codon consists of three, nonoverlapping, nucleotides. The code is…
Q: Describe the specificity between the amino acid carried by a tRNA and a codon in mRNA.
A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…
Q: Refer to the information on the genetic code. Use this information to determine how many amino acids…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: Summarize the mRNA translation steps of protein synthesis, which are: initiation, elongation, and…
A: Translation is the process of synthesis of proteins from mRNA.
Q: Examine the diagram below. At which times is transcription and not translation occurring? Production…
A: The phenotypic characteristics of an organism are controlled and regulated by its proteome, and each…
Q: If a sequence of mRNA is CUG AGU GCA, which of the following is the DNA segment from which it was…
A: DNA sequencing is defined as the way of determining the sequence of nucleic acid by identifying the…
Q: Explain the process of Transcription and Translation.
A: Fragments of DNA that are responsible for different traits are known as genes. The expression of…
Q: Explain the process of mRNA to DNA translation.
A: Translation is the process of decoding the mRNA and building a polypeptide chain by the information…
Step by step
Solved in 3 steps with 1 images
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
- A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- Ghe sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
- Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterUsing the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G