Biological MacromoleculesUnderstanding that DNA replication is semiconservative-pil...0/5JuliannaThe coding (sense) strands of two complete (double-stranded) DNA molecules have the base sequences shown in the table below. Two replication experimentsare done with each molecule:1. In Experiment #1, samples of each DNA molecule are incubated with radioactive adenine, along with appropriate replication enzymes, ATP, adenine,thymine, and cytosine.Experiment #1 is stopped when each DNA molecule has replicated once.2. In Experiment # 2, all the DNA molecules from #1 are purified, and then incubated with with a similar reaction mixtureis used this time.Experiment #2 is stopped when each DNA molecule has replicated one more time.-?except non-radioactive adenineoloPredict the percentage of DNA in each sample that is radioactive after each experiment. Round your answers to the nearest percent.DNAcoding strand sequence5'- TGGCTG-3'5'- ACGGGC-3'% of DNA radioactive after...Experiment #10%0%X5Experiment #2□%%ExplanationCheckescF2F1#80F3$F4MacBook Air%Λ&F72024 McGraw Hill LLC. All Rights Reserved.Terms of Use | Privacy CenterAccessibility*F10F12

In Experiment #1, the first replication round involves the incorporation of radioactive adenine into…

Answered: Biological Macromolecules Understanding…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Similar questions

Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in in
DNA Replication For the following piece of DNA, draw the replicated piece of DNA show me where the original and replicated strands of DNA end up. A ATCCGTTACCCA A ACGATATC C GTTA AC C GC G ITAG GCA ATGG GTTTG CTATAG GCA ATTGG C G C
Which statements are true? Explain why or why not.1 The different cells in your body rarely havegenomes with the identical nucleotide sequence.2 In E. coli, where the replication fork travels at 500nucleotide pairs per second, the DNA ahead of the fork—in the absence of topoisomerase—would have to rotate atnearly 3000 revolutions per minute.3 In a replication bubble, the same parental DNAstrand serves as the template strand for leading-strandsynthesis in one replication fork and as the template forlagging-strand synthesis in the other fork.4 When bidirectional replication forks from adja-cent origins meet, a leading strand always runs into a lag-ging strand.5 DNA repair mechanisms all depend on the exis-tence of two copies of the genetic information, one in eachof the two homologous chromosomes
Replication of a circular DNA molecule can occur by either theta () replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe differences between the two approaches to replication - an accurate statement about one form of replication that does not clearly indicate how the other form differs is not a correct)
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
DNA Replication Drawing Name: Using penci, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate. 1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up which is which) 2 Label the replication fork 3. Draw and label helicase 4. Label the overall direction of DNA replication 5. Draw and label single stranded binding proteins 6. Draw and label the leadng strand 7. Draw and label a single DNA polymerase IIl on the leading strand 8. Draw and label an RNA primer on the leading strand 9. Draw and label a DNA polymerase I on the leading strand 10. On the lagging strand, draw and label at least three Okazaki fragments 11. On the lagging strand. draw and label at least two DNA polymerase IIl…
(a) How fast does template DNA spin (expressed in revolutions per second) at an E. coli replication fork? (b) What is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme relative tothe template?
I. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7. HINT: Refer to the slide show and video lecture on this topic to help you solve this one: Synthesis of RNA primers (priming) Ligation II. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that is four amino acids long. Identify which DNA strands are the coding and the transcribed template strands by circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction of transcription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces to the left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands. READ CAREFULLY: The table gives you the possibility of filling in answers that show transcription from either strand or in either direction. You are only required to fill in the information relevant to ONE PEPTIDE (no others). Refer to the genetic code on the…
vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS