II. DNA Capsid- VIRUS HOST CELL Viral DNA mRNA ww Viral DNA Capsid proteins III. IV. Viral reproductive cycle In the figure, what enzyme is utilized to synthesize mRNA (arrow marked III)? 00000 Viral DNA polymerase Host cell DNA polymerase Reverse transcriptase Viral RNA polymerases Host cell RNA polymerase
Q: Which of the following molecules is an inducer of the lac operon: a. Galactose d. Isothiocyanate b.…
A: The lac operon may be a well-studied model of gene control in microscopic organisms, notably E.…
Q: write the different types of carbohydrates. List 6 examples of carbohydrates that you eat and state…
A: Carbohydrates:Essential biomolecules that provide energy for the body.Types of Carbohydrates:Simple…
Q: Discuss some methodological approaches that can be used to examine the influence of multiple genes…
A: It is important to note that these approaches have their strengths and limitations and are often…
Q: Police forensic services frequently use biotechnology as a tool to investigate crimes. Agents of…
A: The NYPD forensic department would likely employ various biotechnological methods to analyze the…
Q: ering where Fucus lives, what do you think is the function of its gelatinous sheath?
A: Fucus, commonly known as rockweed or bladderwrack, could be a sort of brown algae found in…
Q: 1. Describe one of the main functions of the skeleton inside the body. 2. Describe one reason why…
A: 2. Bone is constantly undergoing a remodeling process to maintain strength and adapt to changes.…
Q: please answer
A: 1.The population experiencing the Epidemic are AC. This is because, epidemic is the sudden outbreak…
Q: 9.1 Nematodes and Plathelmithes frequently inhabit the intestine of their hosts. Compare the…
A: Nematodes (roundworms) and Platyhelminthes (flatworms), although both are common parasites that…
Q: Using the attached table that shows the total score for submissive and dominant behaviors of the…
A: 1. The interpretation of the data: The table presents information on dominating scores, which…
Q: Plot the dose response curve and find what the slope factor for a human. Determine the concentration…
A: To plot the dose-response curve and find the slope factor, we can use the data provided for female…
Q: please answer all if possible i need it badly and asap make sure its correct
A: 16. The hormone that initiates the development of specialized cells in the ovaries of women and…
Q: The hypothetico-deductive method in science includes all of the following components except: logical…
A: The hypothetico-deductive method is a proposed description of scientific method. According to it,…
Q: Describe and explain the similarities in bone structure between the Australopithecus afarensis and…
A: I hope these suggestions and recommendations help you with your assigned tasks. To further…
Q: The gel image below shows 7 alleles, let’s call them 1-7 in order of size, with 1 being the largest…
A: Detailed explanation: Let's delve deeper into how to analyze a gel electrophoresis image to…
Q: Kepler’s third law can be stated mathematically as: velocity = distance/time (years)2 = (A.U.)3 S =…
A:
Q: Which of the following would result in performing a manual differential after an automated…
A: The objective of the question is to identify the reason for performing a manual differential after…
Q: Answer the following questions about insulin: Describe DNA methylation and how it impacts gene…
A: Approach to solving the question:Read and understand the question.Answer the questions by…
Q: In the first cycle of fatty acid synthesis via the acyl carrier protein system, the acetyl group on…
A: In this reaction:The acetyl group is denoted as CH3-C(=O)-S-R1.The malonyl-ACP is represented as…
Q: Based on this tree, fill in the table below it, using 1 to indicate the presence of a trait and 0 to…
A: Important information:1 = indicates presence0 = indicates absenceWe can use this to complete the…
Q: A graduate student was assaying LD50 (lethal dose 50%) of two temperature-sensitive Francisella…
A: let's break it down further: 1. **Understanding LD50**: LD50 (Lethal Dose 50) is a measure of the…
Q: Based on the attached figure (Fig. Box 18B of the textbook), what is the output structure of the…
A: Let's analyze the options and discuss why each one is correct or incorrect: Step 1: A.…
Q: Impedance technology is based on the fact that blood cells increase electrical conductivity in…
A: The objective of the question is to determine the validity of the statement: 'Impedance technology…
Q: In the role of the P-site and A-site what is: The Processes in the Central Dogma. Identify where…
A: Of course, let's delve into each aspect in more detail:1. Processes in the Central Dogma: -…
Q: Genetics Q10
A: The objective of the question is to determine the number of DNA fragments that will be produced when…
Q: iruses that kill host cells are (a) lysogenic (b) lytic (c) viroids (d) prophages (e) temperate
A: In virology, the relationship between viruses and their host cells can lead to diverse results,…
Q: What does “descent with modification” mean? a. Populations that change quickly are likely to become…
A: "Descent with modification" is a core concept in evolutionary biology that Charles Darwin…
Q: What is Lc-Ms-Ms System?
A: The combining of the separating capacity of liquid chromatography with the very selective and…
Q: What happens: Rising sea surface temperatures and changes in ocean currents contribute to the growth…
A: The objective of the question is to understand how climate change, specifically rising sea surface…
Q: One of the main characteristics that defines the hominin tribe are their bipedal tendencies.…
A: Approach to solving the question. Key references:Article: Kimbel, W. H., & Villmoare, B. (2016).…
Q: Snuffle Snork TAC CAA AGA AAT ATT TAC ATG GGT GTT GTC TTC ACT TAC GAG GAT AGC CGC ATC TAC CAA CGA…
A: The objective of this question is to understand how DNA determines the traits of an organism. In…
Q: Explain the relationship between DNA sequence, amino acid sequence, and protein structure and…
A: let's break it down step by step:DNA Sequence: DNA, or deoxyribonucleic acid, is the genetic…
Q: A map of a pond ecosystem
A: An individual or organism carries out all the life processes and is considered a distinct entity. It…
Q: Body openings are lined by mucous membranes where a barrier, covered by mucus, secreted by peptides…
A: Epithelial Cells: These are the cells that line the body's surfaces, including the surfaces of body…
Q: Covid-19 pandemic has been the subject of incredible conspiracy theories. Based on knowledge of…
A: The explanation is incorporated into the answers.
Q: simple cases of skin cancer can be treated by Select one: a. dermatologist b. neurologist c.…
A: To sum up, dermatologists are the main medical specialists in charge of identifying, managing, and…
Q: RBCs are recycled constantly through the bone marrow. Question 11 options: True…
A: Production and Lifespan of Red Blood Cells (RBCs)Red blood cells (RBCs), also known as erythrocytes,…
Q: Thrombocytosis, an elevated platelet count, occurs in some cancers and in qualitative disorders of…
A: The question is asking whether thrombocytosis, which is a condition characterized by an elevated…
Q: Discussion 1 pts Meets Standards A complete and accurate description of the difference between…
A: *In genetics and cell biology, homologous chromosomes and sister chromatids are fundamental ideas.…
Q: How does light pollution negatively impact sea turtles / the aspect of human health? Explain.
A: Approach to solving the question:Light pollution disrupts a vital navigation system for sea turtle…
Q: A original pedigree: 8 alleles 3 78 13 1 2 12 34 34 5 6 23 56 7 8 9 10 11 12 37 17 26 25 36 35 Using…
A: We search for situations in which a child has a combination of alleles that could not have been…
Q: How do finches reconize members of their own species?
A: The objective of the question is to understand how finches, a type of bird, recognize members of…
Q: 5. Cross a heterozygous tall plant with a short plant. In letters, what are the genotypes? and…
A: Step 1:We can use a Punnett Square to visualize the cross between a heterozygous tall plant (Tt) and…
Q: Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a)…
A: DNA is a double-stranded molecule. DNA replication is semi-conservative. This means that each DNA…
Q: For question 1 what the answer And answer question 4 Please is Antro Answer it now
A: Approach to solving the question: used the image in answering the question Detailed explanation:…
Q: 1. Suppose that the three samples are from two parents and their child. Which individuals are the…
A: Approach to solving the question:Blood types are determined by the presence or absence of certain…
Q: A premature infant typically lacks subcutaneous adipose tis- sue. Also, the surface area of an…
A: A imperative physiological work, thermoregulation, the capacity to regulate body temperature…
Q: fueled.brightspace.com/d2l/le/enhancedSequenceViewer/3300467?url=https%3A%2F%2Ff59af8a9-95f5-419c-a4…
A: The objective of the question is to identify the most accurate statement about gene expression and…
Q: how does the process of exhalation influence the pH of blood, considering the role of carbon dioxide…
A: IntroductionThe process of exhalation plays a crucial role in maintaining the pH of blood by…
Q: Each of the following terms represents a type of economic value we place on the services we get from…
A: The term "Existence" does not represent an economic value placed on the services we get from an…
Q: Bacteriophages that can enter into stable, long-term rela- tionships with their hosts are called:…
A: Viruses that infect bacteria are known as phages or bacteriophages. These organisms have a…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letterOF rasc PDF Teas fill Which of the following is NOT a step in the replication of a retrovirus? A diagram illustrating the process is provided below. PDF UNOFFIC TRANSCR 59°F Mostly cloudy Virus Viral RNA Reverse transcriptase DDDDDD ↓Viral DNA Provirus mRNA mm Proteins mn Viral RNA Protease Plasma membrane Host DNA New virus O The single-stranded DNA forms a double-stranded DNA called a provirus, which is incorporated into the host cell DNA. O After a retrovirus attaches to the host cell, it injects its viral DNA and uses the host cell's machinery and materials to replicate. O After a retrovirus injects its viral RNA into a host cell, it forms a DNA strand by reverse transcription. O When the host cell replicates, a provirus produces the viral RNA needed to produce more virus particles. P O Search hun recc PDF maste omiss
- Alternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…AUG Met ACG ANALYSIS ANALYSIS: A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template is given below: Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-СТT-CGT-3 DNA daughter strand: hnRNA: MRNA: original protein: mutated MRNA: mutated protein: second letter G UCU UUU Phe UAU Tyr UGU UGC Cys UAA stop UGA stop| A UAG stop UGG Trp UUC UCC UAC Ser Leu UCA UUG UUA UCG G CUU CCU CAU CGU His CAC CAA CUC C CGC Leu CUA Pro Arg A ССА CGA Gln CAG CUG CCG CGG AUU ACU AAU AUC lle A AUA AAC Asn AAA AGC AGA AGU Ser ACC Thr АСА AAG LyS GAU ASP AUG Met ACG AGG Arg G GUU GCU GGU) GUC GCC GAC GGC Val GUA GCA Ala GAA Gly GGA A Glu GUG GCG GAG GGG G Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be? The original protein is [A] (For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H). first letter third letter2. Here is the detailed view of the MCS of the PUC19 plasmid: Sma I KpnI SbfI PstI SacI XbaI ECORI BamHI Sall SphI HindIII agt GAATTCGAGCTCGGTACCCGGGGA TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGcgtaatcatggtcat 400 410 420 430 440 450 460 ...S N S SP VR PDEL TS R CAH LS P T IM T M lacZa translational start Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA that would be cut out. Show both strands. For reference, here are the recognition sequences: 5' G|GAT СС 3' 3' С СТАG|G 5' recognition sequence for BamH I 5' G GTAC|C 3' 3' cl CATG G 5' recognition sequence for Kpn I Figure 26: recognition sequences for BamH I and Kpn I
- BONUS: Why can't RNA viruses use cellular RNA Polymerase to copy their genetic information? Because cellular RNA Polymerases are O RNA Dependent RNA Polymerase O RNA Dependent DNA Polymerase O DNA Dependent RNA Polymerase O DNA Dependent DNA Polymerase prt s homeF3 3 E Which process is illustrated in the diagram? D VW/VVVVVVVVX C Replication Transcription RNA processing Translation 5' Gene expression F4 Q Search R F F5 % 5 V T F6 G 6 O Y F7 H & 7 U B N F8 99+ F9 * 8 8 J 1 1 5 3' N ( 9 9 MO F10 Alt K 2 O 6 P L 3 A F12 ? Ctrl25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St
- III. DOUBLE MATCHING TYPE choose the enzyme/protein/requirement in Column A, and the processes/stages where it occurs in COLUMN B. Column A Column B Enzyme/Proteins/ Requirements Processes/Stages A. RNA polymerase B. DNA polymerase I C. DNA polymerase III D. Single strand binding protein E. Sigma factor F. Ligase G. Peptidyl transferase L Replication initiation i. Replication elongation iI. Transcription initiation iv. Transcription elongation v. Transcription termination vi. Activation of amino acids vii. Translation initiation viii. Translation elongation ix. Translation termination H. Primers I. Aminoacyl synthetase J. Gyrase K. Release factors L Rho factor M. AUG-fmet N. Initiation factorsvvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNAPriming for virus DNA replication can happen by all of the following EXCEPT: O a. Primase adding a RNA primer O b.Recognition of a promoter region Oc. Self-priming by formation of a hairpin secondary structure at the ends which have inverted terminal repeats (ITRS) O d.Using a protein (example: terminal protein at the 5' end of the genome) 1 F If there was no reverse transcriptase available, a DNA virus could still replicate its genome. O True O False Seve All Answers