What would life be like for photosutotrophs if there were no chemoheterotrophs? for chemoheterotrophs if there were no photosutotrophs?

Q: Why are most marine photosynthesizers unicellular?

A: A single-cell organism that carries out all the necessary life processes is called a unicellular…

Q: What are the two types of cells that help cyanobacteria live on "thin air" and water? What are the…

A: Cyanobacteria: Cyanobacteria are blue-green algae microorganisms that look like bacteria. Gas…

Q: Chloroplast formation in zygotes of algae?

A: The structure that is responsible for conducting photosynthesis in the plant system is known as…

Q: When do bacteria form endospores? a-When environmental conditions are unfavourable b-When they want…

A: Introduction :- Spores known as endospores are produced inside of cells, primarily in bacteria.…

Q: How can the hypothesis that asserts that chloroplasts as well as mitochondria were primitive…

A: INTRODUCTION Mitochondria are called the powerhouse of the cells converting fuel molecules into…

Q: What is the role of chloroplast in green algae?

A: Algae are significant because they are the primary producers of biomass in the aquatic ecosystems.…

Q: For the organisms in the picture below: 1. To what kingdom do they belong? 2. Are they prokaryotic…

A: Unicellular organisms are not visible to the naked eye. Their visualization requires the use of…

Q: Give typing answer with explanation and conclusion 15 ) Which below are specialized for life in a…

A: The movement of water from higher concentration towards lower concentration through a semipermeable…

Q: Why did the discovery of archaea generate interest in searching for cells on other planets?

A: A domain consisting of single-celled organisms  The members are of varied shapes namely spiral,…

Q: Which chlorophyll pigment is found in golden and brown algae?

A: Golden algae are one of the defined types of algae that live in freshwater.  The class is more…

Q: What is Eubacteria?

A: Bacteria are the most important microorganisms to the food processor. Some bacteria are beneficial…

Q: Why might chemosynthetic communities exist only in places like the deep-ocean floor rather than…

A:

Q: Evolution of what biological process is hypothesized to have been made possible by the appearance of…

A: Introduction :- Chlorophyll is a group of green pigments found in the mesosomes of cyanobacteria and…

Q: Why do eukaryotes have the potential to become multicellular? Do prokaryotes have this capability?…

A: At least 1.7 billion years ago, multicellular creatures arose from unicellular eukaryotes.…

Q: What distinguishes brown algae from green algae? The chloroplast structures are different Brown…

A: Brown algae differ with green algae in terms of chloroplast structures.

Q: Are there chloroplasts in cyanobacteria?

A: Cyanobacteria are the autotrophic bacteria which can conduct photosynthesis.

Q: To which two domains do theprokaryotes belong?

A: There are many different types of living organisms found on the planet. The arrangement of organisms…

Q: Which of the following statements is correct? a) Chloroplasts are only found plants O b)…

A: The following statement is correct.

Q: From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to…

A: BLAST (Basic local alignment search tools) is online algorithm and program to compare the biological…

Q: What are chemotrophs vs. autotrophs?

A: An autotrophs are primary producers who can produce their own food. Autotrophs are divided into…

Q: What is the endosymbiotic theory? How does it help to explain some of the characteristics of…

A: Endosymbiotic theory is the theory of origin of the eukaryotic cells. There are many differences…

Q: What is the relationship between Cyanobacteria and the chloroplast of phytoplankton (algae)?

A: Photosynthesis is the process by which organisms use sunlight to produce energy. In the presence of…

Q: What is not part of a Bacterial cell base on the picture?

A: All the living organisms are made up of cells. These are the functional units of life that have…

Q: Why didn't photosynthesis progress earlier in the Archaean?

A: Photosynthesis is the cellular process by which plant use sunlight for sun, water from soil, and Co2…

Q: Bacteriorhodopsin, and retinal, are part of a transmembrane complex that uses of sunlight to create…

A: Photosynthesis is a process in which the photosynthesis organisms like plants and some bacteria use…

Q: A scientist claims that the Presence of aquaporins is in chloroplast membrane support that…

A: Aquaporins are also known as water channels.They are channel proteins from a larger family of major…

Q: How many endosymbiotic events are required to account for the diversity of photosynthetic…

A: Endosymbiont is an organism that lives within another organism and sometimes maintains a mutualistic…

Q: In what ways are the prokaryotes metabolically diverse? How is this diversity helpful with respect…

A: Introduction Prokaryotes have adapted to live in almost every part of the planet's surface. They can…

Q: How does the process of photosynthesis in archaea different from the protein synthesis of bacteria

A: Photosynthesis is a process by which bacteria (Six phyla), algae, archaea (halobacterium), and…

Q: What phylogenetic and physiological evidence suggests thattoday’s hyperthermophiles are the closest…

A: Introduction: Hyperthermophiles are organisms that have the ability to survive in extremely high…

Q: Glycerol-3-phosphate lipids are found in the cell membranes of which prokaryotic kingdom? kingdom…

A: The objective of the question is to identify the prokaryotic kingdom in which Glycerol-3-phosphate…

Q: Case study on blood

A: Blood DisordersA 25-year-old female patient, Jane, presents with fatigue, weakness, and easy…

Q: Name the photosynthetic organelle of brown algae.

A: Brown Algae are the species which are multicellular and as the name suggests it is brown or greenish…

Modes of Nutrition

It is a biological process of providing or obtaining food that is necessary for growth and health. It includes many physiological processes - absorption, ingestion, assimilation, catabolism, excretion, etc. In biology, the science that deals with nutrition's physiological and chemical processes are called "nutritional science."