Anatomy and Physiology by OpenStax
17th Edition
ISBN: 9781506698021
Author: J. Gordon Betts;Dean H. Kruse;Kelly A. Young;Peter DeSaix;Brandon Poe;Oksana Korol;James A. Wise;Eddie Johnson;Jody E. Johnson;Mark Womble
Publisher: XANEDU PUBLISHING
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3, Problem 22RQ
How many “letters” of an RNA molecule, in sequence, does it take to provide the code for a single amino acid?
- 1
- 2
- 3
- 4
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
List the three (3) types of RNA molecules and in one sentence each describe their functions.
An RNA molecule has the following percentages of bases: A = 23%, U = 42%, C = 21%, and G = 14%.
Q. Is this RNA single stranded or double stranded? How can you tell?
The genetic code
uses combinations of 3 RNA bases as letters, each triplet specifies only one amino acid
uses combinations of 3 RNA bases as letters, each triplet can specify more than one amino acid
uses combinations of 3 DNA bases as letters to specify the amino acids
uses combinations of 3 tRNA bases as letters to specify the amino acids
Chapter 3 Solutions
Anatomy and Physiology by OpenStax
Ch. 3 - Visit this link...Ch. 3 - Watch this video...Ch. 3 - Watch this video...Ch. 3 - Watch this video...Ch. 3 - Visit this link...Ch. 3 - Because they are embedded within the membrane, ion...Ch. 3 - The diffusion of substances within a solution...Ch. 3 - Ion pumps and phagocytosis are both examples of...Ch. 3 - Choose the answer that best completes the...Ch. 3 - Choose the term that best completes the following...
Ch. 3 - The rough ER has its name due to what associated...Ch. 3 - Which of the following is a function of the rough...Ch. 3 - Which of the following is a feature common to all...Ch. 3 - Which of the following organelles produces large...Ch. 3 - The nucleus and mitochondria share which of the...Ch. 3 - Which of the following structures could be found...Ch. 3 - Which of the following sequences on a DNA molecule...Ch. 3 - Place the following structures in order from least...Ch. 3 - Which of the following is part of the elongation...Ch. 3 - Which of the following is not a difference between...Ch. 3 - Transcription and translation take place in the...Ch. 3 - How many letters of an RNA molecule, in sequence,...Ch. 3 - Which of the following is not made out of RNA? the...Ch. 3 - Which of the following phases is characterized by...Ch. 3 - A mutation in the gene for a cyclin protein might...Ch. 3 - What is a primary function of tumor suppressor...Ch. 3 - Arrange the following terms in order of increasing...Ch. 3 - Which type of stem cell gives rise to red and...Ch. 3 - What multipotent stem cells from children...Ch. 3 - What materials can easily diffuse through the...Ch. 3 - Why is receptor-mediated endocytosis said to be...Ch. 3 - What do osmosis, diffusion, filtration, and the...Ch. 3 - Explain why the structure of the ER, mitochondria,...Ch. 3 - Compare and contrast lysosomes with peroxisomes:...Ch. 3 - Explain in your own words why DNA replication is...Ch. 3 - Why is it important that DNA replication take...Ch. 3 - Briefly explain the similarities between...Ch. 3 - Contrast transcription and translation. Name at...Ch. 3 - What would happen if anaphase proceeded even...Ch. 3 - What are cyclins and cyclin-dependent kinases, and...Ch. 3 - Explain how a transcription factor ultimately...Ch. 3 - Which of the following structures could be found...
Additional Science Textbook Solutions
Find more solutions based on key concepts
(a) Take the slope of the curve in Figure 2.64 to find the jogger's velocity at t=2.5 s. (b) Repeat at 7.5 s. T...
College Physics
Raw Oysters and Antacids: A Deadly Mix? The highly acidic environment of the stomach kills most bacteria before...
Microbiology with Diseases by Body System (4th Edition)
Name the components (including muscles) of the thoracic cage. List the contents of the thorax.
Human Physiology: An Integrated Approach (8th Edition)
CAUTION Why does the presence of extinct forms and transitional features in the fossil record support the patte...
Biological Science
In a mark-recapture study, an ecologist traps, marks, and releases 25 voles in a small wooded area. A week late...
Study Guide for Campbell Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Why is DNA and not any other macromolecule represents the genetic code?arrow_forwardUse the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterarrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for a protein in this mRNA?c. what stop codon is present in this mRNA?arrow_forward
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?arrow_forwardWhich of the following stretches of RNA is most likely to form a hairpin with 4 bases making up the turn? UUGCGCAUAACG GCUAUUCCGCUA CACGAUUCGCAC OG CUCUAAGGAGCarrow_forwardFirst base of RNA codon Provide the sequence of amino acids that would be translated from the following strand of RNA. Use the chart provided below: Second base of RNA codon U A UUU UCU UAU UGU Phenylalanine Tyrosine Cysteine UUC (Phe) UCC UAC (Tyr) UGC (Cys) C U Serine UUA UCA (Ser) UAA Stop UGA Stop Leucine UUG (Leu) UCG UAG Stop UGG Tryptophan (Trp) G CUU CCU CAU CGU Histidine CUC CCC CAC (His) CGC 0 Leucine Proline Arginine CUA (Leu) CCA (Pro) CAA CGA (Arg) Glutamine CUG CCG CAG (Gln) CGG AUU ACU AAU AGU Asparagine Serine AUC Isoleucine ACC AAC (Asn) AGC (Ser) A (lle) Threonine AUA ACA (Thr) AAA AGA Lysine Arginine AUG Met or start ACG AAG (Lys) AGG (Arg) GUU GCU GAU GGU Aspartic GUC GCC GAC acid (Asp) GGC G Valine Alanine Glycine GUA (Val) GCA (Ala) GAA GGA (Gly) Glutamic GUG GCG GAG acid (Glu) GGG AUGGGC CUAGGAUUUCCAACCUAG Edit View Insert Format Tools Table 12pt Paragraph BI U T² : Third base of RNA codonarrow_forward
- What do you mean by mRNA and tRNA?arrow_forwardIn RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a single tRNA molecule to recognize more than one codon using its one anticodon sequence. It requires a shift in position of the two nucleotides. Guanine and uracil come together in this unusual pair via 2 hydrogen bonds. Based on what you know about hydrogen bond formation and base pairing, draw a guanine nucleotide and a uracil nucleotide hydrogen bound to one another.arrow_forwardAn RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G = 15%. (A) Is this RNA molecule single-stranded or double stranded? How can you tell? (B) What would be the percentage of each of the bases in the template strand of the DNA that contains the gene for this RNA?arrow_forward
- The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the + Jend.arrow_forwardWhat is the complementary sequence of the following DNA strand: AATCGTCTAAGGCCarrow_forwardRNA nucleotides can undergo versatile base pairing. What does this mean, and what is the consequence for the structure of RNA? Please help simplify/explain this in 5 sentences or lessarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY