Loose-leaf Version for What Is Life? A Guide to Biology 4E & LaunchPad for What is Life? A Guide to Biology 4E (Twelve Month Access)
4th Edition
ISBN: 9781319154639
Author: Jay Phelan
Publisher: W.H. Freeman & Co
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 3, Problem 13SA
Summary Introduction
To review:
a) What determines the information contained in a segment of DNA.
b) Why researchers working on the Human Genome Project describe the sequence of only one strand of DNA.
Introduction:
DNA consists of specific sequences of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In general, which part of a DNA sequence will have the best quality? (Ex. Beginning, middle, end?) Why?
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right.
CCTACCTTATGCCAAGTTGGGGATAAACTC
The left end of this molecule is the
end.
How many amino acids will be in the protein translated from this sequence?
What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence?
The label on the end of the protein that is translated first is the
+ Jend.
In your own words
Chapter 3 Solutions
Loose-leaf Version for What Is Life? A Guide to Biology 4E & LaunchPad for What is Life? A Guide to Biology 4E (Twelve Month Access)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946 nucleotides long. The urn contains 259 Adenines, 699 Cytosines, 401 Thymines and 587 Guanines How many start codons will I find on average in the entire sequence when I draw all of the bases from the urn without replacement? Please I'm not too sure how to tackle this.arrow_forwardA compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?arrow_forwardWe have talked about several examples of cis-acting elements that have dyad symmetry (inverted repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give one example of one that functions at the DNA level and briefly explain why the sequence requires dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of the element. Edit View Incort Format Tools Tabloarrow_forward
- What are cis acting DNA sequences? List themarrow_forwardWhat is generated from the replication of DNA ? what method is used ? Describe the process. What are Okazaki fragments? What enzymes are used ?arrow_forwardBelow is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3arrow_forward
- How can DNA fragments be separated by size?arrow_forwardThe sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. ССТАССТТАТGCСАAGTTGGGGATАААСТС The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is th v end. 5' Please answer all parts of the question. carboxyl 3' aminoarrow_forwardHow many nucleotides does the human genome contain?arrow_forward
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixarrow_forwardHow many kilobases of the DNA strand below will code for the protein product?arrow_forwardWhat percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License