EBK CAMPBELL BIOLOGY
10th Edition
ISBN: 9780136539414
Author: Reece
Publisher: VST
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 28.3, Problem 2CC
WHAT IF? Ø Would you expect the plastid DNA of photosynthetic dinoflagellates, diatoms, and golden algae to be more similar to the nuclear DNA of plants (domain Eukarya) or to the chromosomal DNA of cyanobacteria (domain Bacteria)? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
. In examining Figure 3-19, what do you think is the mainreason for the difference in size of yeast and humanmtDNA?
Draw phylogenetic tree of the given newick format :((A,B,(C,D)),(E,F))
help
Chapter 28 Solutions
EBK CAMPBELL BIOLOGY
Ch. 28.1 - Cite at least four examples of structural and...Ch. 28.1 - Summarize the role of endosymbiosis in eukaryotic...Ch. 28.1 - Prob. 3CCCh. 28.2 - Why do some biologists describe the mitochondria...Ch. 28.2 - WHAT IF? DNA sequence data for a diplomonad, a...Ch. 28.3 - Explain why forams have such a well-preserved...Ch. 28.3 - WHAT IF? Would you expect the plastid DNA of...Ch. 28.3 - Prob. 3CCCh. 28.3 - Prob. 4CCCh. 28.4 - Contrast red algae and brown algae.
Ch. 28.4 - Why is it accurate to say that Ulva is truly...Ch. 28.4 - Prob. 3CCCh. 28.5 - Contrast the pseudopodia of amoebozoans and...Ch. 28.5 - Prob. 2CCCh. 28.5 - Prob. 3CCCh. 28.6 - Justify the claim that photosynthetic protists are...Ch. 28.6 - Prob. 2CCCh. 28.6 - WHAT IF? High water temperatures and pollution...Ch. 28.6 - MAKE CONNECTIONS The bacterium Wolbachia is a...Ch. 28 - Describe similarities and differences between...Ch. 28 - What evidence indicates that the excavates form a...Ch. 28 - Prob. 28.3CRCh. 28 - On what basis do systematists place plants in the...Ch. 28 - Describe a key feature for each of the main...Ch. 28 - Prob. 28.6CRCh. 28 - Plastids that are Surrounded by more than two...Ch. 28 - Biologists think that endosymbiosis gave rise to...Ch. 28 - Prob. 3TYUCh. 28 - According to the phylogeny presented in this...Ch. 28 - In a life cycle with alternation of generations,...Ch. 28 - Based on the phylogenetic tree in Figure 28.2,...Ch. 28 - Prob. 7TYUCh. 28 - SCIENTIFIC INQUIRY Applying the If then logic of...Ch. 28 - WRITE ABOUT A THEME: INTERACTIONS Organisms...Ch. 28 - SYNTHESIZE YOUR KNOWLEDGE This micrograph show's a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A major difference between hereditary information in eukaryotes and prokaryotes is: a. in prokaryotes, the hereditary information is distributed among individual, linear DNA molecules in the nucleus. b. in eukaryotes, the hereditary information is encoded in a single, circular DNA molecule. c. in prokaryotes, the hereditary information is usually distributed among multiple circular DNA molecules in the cytoplasm. d. in eukaryotes, the hereditary information is distributed among individual, linear DNA molecules in the cytoplasm. e. in eukaryotes, the hereditary information is distributed amoung individual, linear DNA molecules in the nucleus.arrow_forward. The position of the gene for the protein actin in the haploid fungus Neurospora is known from the complete genome sequence. If you had a slow-growing mutant thatyou suspected of being an actin mutant and you wantedto verify that it was one, would you (a) clone the mutantby using convenient restriction sites flanking the actingene and then sequence it or (b) amplify the mutantgene by using PCR and then sequence it?arrow_forwardPlease asaparrow_forward
- 5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Compare each organism's Cytochrome CDNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome CDNA sequences from ancestor cell. ANCESTOR CELL A T T AG C G A CCAGTATA T C C TAC A A T C C G TCTAC T T CATTO ATTAGCG A CCA GT TT AT C CTACA ATC C C G T CTACTT CAT11 ATTAT c G AC C A GT TT AT CCT ACATT CC c G TATACTTC GT 14 АМОЕВА SPONGE EARTHWORM C T TAT C G A C c c G TT T ATC CTACA TT C C c GT CT A CTT CGT CTTAT Cc ccc CGTTTATCCTACTTTCCCGT CT A CTTCGT CT A AT c cccc c GT T T ATC CTACT TTCCC G T CT A CTT CGT CT A AT c c ccc c G T T T AT C CTA CTT T C C CATCTACTA CTA AT ccc c c c GT T TATCCTACT TT C C CAT GT AGTA TAAT Ccc c c c GT T T AT c CTACT TT C C CATCTACTAAGT SHARK LIZARD KANGAROO GT DOLPHIN GT СAT 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is…arrow_forwardPlease fill in the blanksarrow_forwardBONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicasesarrow_forward
- Using the Figure below briefly describe four basic molecular genetic processes. What is a duration of these processes in an averaged human cell?arrow_forwardGiven the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?arrow_forward*00 g organisms use nformation from e is nearly identical ants, and animals. These two enzymes are found in nearly all living organisms. When you studied the cytoskeleton, you learned about the proteins actin and tubulin. Actin and tubulin are found in all eukaryotes. VAn actin gene in humans is 92% identical to the homologous actin gene in mice. An actin gene in humans is 80% identical to the homologous gene in yeast. What does this say about how long ago these organisms had a common ancestor? rom common lting from common One example of s that determine es determine which which become the Key growth of the front ons in the Hox genes sm's structure. Some nost all multicellular Hox genes must have ncestors. ection at research of the ural selection? to observe natural selection ge happens very slowly. Pa V 9.arrow_forward
- 1. Chromosome type not exhibited by humans. * 2. Chromosome type with noticeably short p-arm. * 3. When is the chromosome maximally compacted? 4.The 3-molecule basic component of the DNA. 5. Formed by a sugar moiety and a nitrogenous base. 6. The nitrogenous base that is replaced by uracil in the RNA. * 7. The complementary base pair of adenine. * 8. The base pair with three hydrogen bonds. * 9. The term that describes the orientation of DNA strands in a DNA molecule. * 10. The term that refers to the spiral arrangement of the DNA.arrow_forwardExtinct Threatened 4-A comparison of DNA or protein sequences from different species can reveal evolutionary relationships. This assumption is based on the idea that the nucleotide or amino acid sequence of a particular gene or the protein it encodes, respectively, mutates at a similar rate in different individuals. However, remember that the rate of mutation alone does not determine how fast a DNA sequence will change. The effects of mutation on survival and reproductive success (natural selection), as well as the generation time of the organism, also play important roles in the overall rate of genetic change in a population. VOLENT Vulnerable (UCN 3.1 EX EW CR EN Why might a non-coding region of DNA be more reliable than a gene like Leptin for building phylogenies? (9)arrow_forwardIf most of the DNA in Bacteria and Archaea is coding DNA and much of the DNA in higher plants and animals is non-coding (does not code for proteins), does this fact make it reasonable that the single-celled Bacteria and Archaea have lower mutation rates per base-pair than do eukaryotes? Why or why not?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license