These are biochemistry questions:Questions are part A and B. You are studying a new operon that you have discovered in E. Coli that you have named the UpLate operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You havediscovered three genes (sleep, wings, and energy) encoded within the polycistronic templatemade from the operon. The transcription start site is indicated at the arrow and the proteinencoding sequences are encoded by the boxes with the names of the genes inside, with a blowup of the nucleotide sequence at the promoter, with the transcription start occurring at the C.(Asterisks for part F)sleepwingsenergy5'-тстTGACАСАТСAGGCTAGCATTATAAAGсCGGCTAGCTAGCATGCAAAGCСТАССТТ-3'3' -ACAACTGTGTAGTCCGATCGTAATATTTCGGCCGATCGATCGTACGTTTCGGATGCAA-5'A. Place boxes around the -10 and -35 elements of the core promoter. What binds to theseregions of the promoter and why is it important? B. What is the first 6 nucleotides of the mRNA sequence generated at this operon?

Answered: Image /qna-images/answer/9f8976be-6be6-444a-b5fa-19140146c157.jpg

Answered: You are studying a new operon that you…

You are studying a new operon that you have discovered in E. Coli that you have named the Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: A. DETERMINING Table 11-1. Osmosis experiment data: mass of bags (g) Time 0 min 15 min 30 min 45 min…

A: Bag no. 2, Bag no. 3 and Bag no. 4 are gaining mass. Water and sucrose molecules both are directly…

Q: TUBE NO. 1. 3 ml of RESULT and OBSERVATION TREATMENT | 2 mL of NAOH solution egg albumin solution…

A: Proteins are macromolecules that are made up of Amino acids joined by peptide bonds. Linear chain of…

Q: A 52 year old male is being treated for colon cancer. The combination of chemotherapy he is…

A: The pH of his blood is too alkaline (basic).The primary cause of the pH imbalance is metabolic.The…

Q: The intracellular fluid compartment includes all water and electrolytes outside of the cell…

A: In physiology, body fluids make up a significant percentage of the human body containing water and…

Q: Define the following terms:a. SAMb. SAHc. THFd. homocysteinee. one-carbon metabolism

A: Introduction- Biomolecules can be found in a biological system in a wide range of sizes in which…

Q: Knowing that the solute concentration of blood is 0.9%, if you were to make 100ml of an intravenous…

A: Given, the solute concentration of blood = 0.9%. We have to make 100mL of the intravenous (IV) fluid…

Q: QUESTION 1: What is the purpose of adding sodium hydroxide (NaOH) to the cheek cell pellet, after…

A: The question relates to a particular step in a DNA extraction protocol, where sodium hydroxide…

Q: How much active ingredient in 20 cc of a 15% solution?

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: 7. Describe the falient features and functions of steroids.

A: Steroids are biologically active compounds. Steroids are found in plants, animals and fungi.…

Q: 4) Cells are made up of: a. Carbohydrates b. Lipids c. Proteins d. Nucleic acids e. All the above

A: Cells are the basic building blocks of all living things. They are the smallest units of life that…

Q: * Question 5 A chemical mean that is best used as a diluted aqueous solution is

A: Introduction Any solutions have two components: Solute and Solvent. Solute is any substance which…

Q: Summarize the article in 4-6 bullet points. How does this article relate to the information you've…

A: There are a few important points.Immunity: It is the ability of an organism to resist infection by…

Q: Using this information, answer the questions below: SOLUTE TESTED FOR POSITIVE CONTROL (COLOUR)…

A: We can test the presence of different kinds of solutes or substances in the unknown solution by…

Q: Dialysis of proteins- the procedure and protocols

A: A. Note：Before entering the laboratory, put on facemasks and gloves. B. Theory： 1. Semipermeable…

Q: The subatomic particle is located in the A has a positive charge and A

A: The question is asking about the characteristics and location of a specific subatomic particle, the…

Q: True or false? Dr Walden ordered a CBC, CMP, and lipid panel on mr. Bowden the medical assistant is…

A: Question is related to true and false. In this question asked about the job responsibilities of…

Q: What is one physiological process or bodily region that is highly sensitive to pH fluctuations? What…

A: Inside the human body, almost every organ has a physiological process or some system which is highly…

Q: What are acids and bases?

A: Any hydrogen containing a substance fit for giving a proton (a hydrogen particle) to one more…

Q: Select the statements that correctly describe SDS‑PAGE. SDS‑PAGE is a protein used as a loading…

A: SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) is a common technique used in…

Q: Nat concentration is known as? and it results in ?. High

A: Sodium- It is a metal, it is denoted by the symbol "Na". It acts as a mineral and an electrolyte in…

Q: The level of omega-3 fatty in a certain brand of fish oil capsule has been disputed. A chemist…

A: In the above given condition, the fish oil capsules are the samples and the omega 3 fatty acid is…

Q: A. List the five tests from your lab report and answer positive or negative for the following…

Q: Answer the given questions, kindly draw a clear illustration of the given. Follow the instructions.

A: The plasma membrane is acted as a capacitor. It contains non-conducting components i.e. hydrophobic…

Q: 1. Knowing that these 2 molecules are always floating in the air, hypothesize why your distilled…

A: Carbon and nitrogen are always floating in air. The carbon forms CO2 and nitrogen forms NO2 in air.…

Q: Through a short essay (min: 100 words), describe the importance of having adequate knowledge of…

A: Biochemistry is a branch of biology that deals with the chemical reaction occurring in an organism.…

Q: What is the use of color reaction tests for proteins in diagnosing diseases? Give an example too!

A: Diagnostics, which can diagnose illness, disorders, or infections, is quickly becoming a critical…

Q: Figure 3: ● • . ● KDa ● 97.4 66.2 45.0 ● 31.0 21.5 14.4 S-1 p-1 2.8 2-d S.3 p-3 This figure was…

A: The study of protein behavior under different conditions is a fascinating aspect of molecular…

Q: Define the following terms:a. triacylglycerolb. neutral fatc. partial hydrogenationd. autoimmune…

A: Introduction: Lipids play an important role in the formation and function of living cells.

Q: Wall Chemistry Matching: Match each of the following with the appropriate chemical (unless otherwise…

A: Cellulose is a polysaccharide composed of repeating glucose units linked by β-1,4-glycosidic bonds,…

Q: What are the clinical importance of the catalase and oxidase tests?

A: Two frequently used clinical microbiology diagnostic tests that aid in identifying bacteria based on…

Q: Which among the following statements is correct? Group of answer choices Both statements are…

A: Chromatography is a technique used for separation of molecules based on the principle of…

Q: An account of the following topic: (i) Structure-Activity Relationships and Drug Design;

A: The structure-activity relationship (SAR) is the correlation between the structure of a molecule and…

Q: What is Huble's Test's primary goal? How does it compare to the Unsaturation Test and how does it…

A: Introduction Lipids are a type of substance that is naturally oily or greasy. They are made up of…

Q: Transition occurs when a purine is replaced by another purine. O True O False

Q: Do an in-depth research about Emil Fischer's Work and contributions to Biochemistry. Please include…

A: He is the second Nobel prize winner in chemistry . His main works was on the sugars and purines…

Q: In living organisms, buffers do which of the following? allow the pH of cells to change without…

A: Introduction pH is a measure of acidity or alkalinity of a solution. pH is defined as the negative…

Q: . Cholesterol can be classified as a steroid and an alcohol As a component of cell membranes,…

A: Cholesterol is a lipid that is predominantly found in the animal world. It performs various…

Q: In the field of pharmacology, what is good and the bad

A: Pharmacology is the study of how drugs interact with living systems to produce therapeutic effects.…

Q: The purine nucleotide bases are:

A: Purines:- Purines are the heterocyclic natural compound that comprises pyrimidine ring melded to an…

Q: What is the principle of Benedict's test?

A: Benedict's test -- It is test which is used to check the presence of a reducing sugar in the sample…

Q: Creare a controlled experiment to test the effect of varying ph, temperature, or enzyme…

A: The enzyme is a protein molecule that carries out various metabolic reactions. It catalyzes the…

Q: 1. Deduce the primary structure of this polypeptide. 2. Why would cyanogen bromide not be a good…

A: a) Given the molecular weight of the peptide is 4000Average MW of an amino acid is 110 Da. So, the…

Question

These are biochemistry questions:

Questions are part A and B.

You are studying a new operon that you have discovered in E. Coli that you have named the Up
Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have
discovered three genes (sleep, wings, and energy) encoded within the polycistronic template
made from the operon. The transcription start site is indicated at the arrow and the protein
encoding sequences are encoded by the boxes with the names of the genes inside, with a blow
up of the nucleotide sequence at the promoter, with the transcription start occurring at the C.
(Asterisks for part F)
sleep
wings
energy
5'-тстTGACАСАТСAGGCTAGCATTATAAAGсCGGCTAGCTAGCATGCAAAGCСТАССТТ-3'
3' -ACAACTGTGTAGTCCGATCGTAATATTTCGGCCGATCGATCGTACGTTTCGGATGCAA-5'
A. Place boxes around the -10 and -35 elements of the core promoter. What binds to these
regions of the promoter and why is it important?

B. What is the first 6 nucleotides of the mRNA sequence generated at this operon?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Fill the following table by choosing the correct answers. Treated by Possible Caused by pH value metabolic acidosis metabolic 수 alkalosis
The following protein quantification utilizes Cu ions except fora. Lowryb. Biuretc.Bradford
The topic is about reducing and non redusing sugar (carbohydrates)
Which of the following statements about pH is (are) true: pH is a measure of free hydrogen ion concentration none of these are true both of these are true An increase in hydrogen ion concentration means a decrease in pH scale units
Describe the reason why the red blood cells placed in one solution swell and burst and also why the red blood cells placed in another solution shrink and wrinkle.
Changes to the sequence of nucleotides in DNA, or changes to chromosomes, are called
Po ~Av Αν Radioactive Thymine (գլոսյա/siunos) 500 400- 300- 200- 100- Radioactive Uracil (counts/minute) Figure 1- Radioactive Thymine E-621 3¶ = = = = 112 0- 100 80- 60- 40- 20 15 20 Time (minutes) Figure 3-Radioactive Uracil 1 1 0- 14 ted States) IT 1 5 10 5 2 10 25 25 20 15 Time (minutes) 1 30 111111 30 V g DNA in broth 35 2- 1.5- 1- 0.5- 0 3 35 Test broth with antibiotic added Control broth with no antibiotic added 1 V 40 glucose concentration to kill the bacteria. 40 Figure 5-DNA in the Broth 2.5- 5 L AaBbCcDdEe AaBbCcDdEe AaBb AaBbC Normal No Spacing Heading 1 Heading 2 Radioactive Methionine 10 (counts/minute) 30,000 25,000- 20,000- 15,000- Figure 2- Radioactive Methionine 10,000- 5,000- 0++ 500- 400- 300- 200- 100- Figure 4- Glucose Concentration 0 25 1 15 20 Time (minutes) LL MacBook Pro 1 30 5 5 f 5 35 W 20 25 15 10 Time (minutes) 10 40 6 LI 25 15 20 Time (minutes) 30 30 35 35 40 40 Foc
Using my chart can you help me with this question. The tests we used were qualitative; they allowed us to determine if a biological molecule was present or absent. In contrast, what type of information would a quantitative test provide?
Directions: Complete the table below and add references.
You can use this as your references: https://www.youtube.com/watch?v=34VkaCJggOM
Study the following urine test results and complete Tables 1 and Write “+” signs in the appropriate boxes of Table 2 to indicate different medical problems. Tests A B C D E Leukocyte Nitrite Protein pH Blood Specific Gravity Ketone Glucose Table 2: Medical Problems Indicated by Urinalysis Results Diagnoses A B C D E Urinary Tract Infection Diabetes Kidney Stone Liver Disease Kidney Disease Unclean catch
A glucose monitor is an instrument that diabetics use to check their blood sugar. To use it, you insert a 'test strip' into the monitor and apply blood to it, then the blood is sucked into the instrument and the concentration of the sugars in the blood are measured. Like most instruments, it isn't 100% accurate 100% of the time. The informational pamphlet includued with the test strips say that a sample with a concentration of 7.2 mg/ml will give a reading with a standard deviation of 0.2 mg/ml. This means that when measured, a sample of blood with a 7.2 mg/ml glucose concentration will give a reading between mg/ml % of the time. mg/ml and