With the aid of a diagram, describe the structure of a flexible endoscope capable of carrying out minor surgical procedures.

Q: If the code for an amino acid is ATG on the DNA molecules, this code on the transfer RNA molecule ma...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: DNA...

Q: Gymnosperms vs. Angiosperms 1) The gymnosperm seed results from and an angiosperm seed results from ...

A: Gymnosperms These are seed-producing plants such as conifers, gnetophytes, cycads, etc. Angiosperms ...

Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...

A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...

Q: Explain the cell division limit and its fail-safe function

A: Introduction  Almost all cells in the body can divide and form new daughter cells however, there are...

Q: Sdve this response. Question 1 Which of the following can cause evolution? Select all that apply. OA...

A: Evolution is change in characteristics of a species over successive generations. The idea of evoluti...

Q: Identify the type of flagella from the picture

A: Introduction :- Flagella are the locomotory structures which are present of the cell surface and all...

Q: Briefly explain the role of genetic testing and the following inherited gene mutations linked to bre...

A: Genetic testing is a type of medical test which is performe to know the defective gene or proteins i...

Q: True or false: Since ATP is generated in chloroplasts, cells capable of undergoing photosynthesis do...

A: ATP stands for Adenosine triphosphates.ATP is a Source of energy for plants and humans to do various...

Q: Differentiate how the function on support is achieved between animals (specifically humans) and plan...

A: The function is support, although similar in outcome, is achieved by vastly different methods in pla...

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...

Q: 3. Which of the following forces is an at a distance force? O Friction O Normal O Applied O Gravity

A: At a distance forces are said to be those forces which acts even when two objects are not in any phy...

Q: What is transpiration

A: A complex traffic material is moving in different directions in a flowering plant, with each organ r...

Q: A bacterial cell undergoes a change and the two Trp codons of the tryptophan leader sequence are con...

A: Tryptophan operon is an example of repressible operon which remain transcriptionally active and beco...

Q: As the number of foxes increases, what happens to the number of mice? O the number of mice stays the...

A: Option B is correct

Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short leng...

A: The transcription is the process by which RNA is produced from the DNA template and the translation ...

Q: 14. A previously well 18-year-old girl is admitted to the ICU because of altered mental status. She ...

A: When water enters the bloodstream from the colon, it quickly reaches osmotic equilibrium with the in...

Q: You are part of the radiology team at an ER.  A 6 year old child comes in, who may have a broken bon...

A: Interpretation of the broken bone X-ray 

Q: What kind of domain is involved with intracellular signaling, cytoskeleton remodeling, and are able ...

A: Pleckstrin homology domain is a protein domain consisting approximately 120 amino acids. 

Q: In a compound microscope consisting of a 5 mm objective lens and an eyepiece (2.5 cm) eyepiece, an o...

A:

Q: The world has been greatly affected by the pandemic caused by COVID-19. Countries all over the world...

A: The pandemic caused by the novel Corona virus has devastatingly affected the countries around the wo...

Q: What is the structure of double-stranded DNA as determined by Watson and Crick?

A: In 1953 Watson and cricks realized that DNA  is made up of two chains of nucleotide pairs and double...

Q: d) Since we know this bacterial organism thrives in colder areas of the world, what can be said abou...

A: NOTE: We are solving parts d and e as mentioned by you. Bacteria that can survive cold temperatures ...

Q: The table below summarises the three stages of Meselson and Stahl's experiment and their results. (a...

A: While proposing the double helical structure of DNA Watson and crick had immediately proposed  for r...

Q: Discuss the 4 lobes of the brain its function and relation to our behavior

A: Our brain is divided into 4 different areas that execute particular functions, these are known as lo...

Q: How biodiversity reflected the environment?

A: Introduction: Biodiversity means the diversity of life forms. It is a word commonly used to refer to...

Q: dentify the statement below that is the MOST TRUE. O All personality traits are equally heritable. O...

A: * inheritance means the passing of characters from parents to their offsprings that is for next gene...

Q: contrast the embryonic development of the starfish and the sea urchin.

A: NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to answe...

Q: Provide consequence or outcome of eugenics

A: Introduction Eugenics:- Eugenics is the selection of desired heritable characteristics in order to i...

Q: What are features of nucleosomes ?

A: Nucleosomes are defined as the basic structural unit of DNA packaging in eukaryotes. Under a electro...

Q: This image is of the very back of the eye. Light would be coming in from the left towards the right ...

A: Eyes are organ that is responsible for vision. The eye ball is located inside in the bony orbit and ...

Q: What is label #7? (snail shell looking thing) A. Cochlea B. spiral valve C. Vestibule D. Eustachian ...

A: Ear is one od the sense organ that help us in hearing. There are majorly divided into 3 parts,  *out...

Q: In Drosophila, Lyra (Ly) and stubble (Sb) are dominant mutations located at locus 40 and 58, on chro...

A: "Genetic variation" is the result of the recombination of genetic material during the inheritance pr...

Q: The cell pictured to the right is in whichstage of nuclear division?a. metaphase II c. anaphase IIb....

A: Mitosis is the phase of the cell cycle where the nucleus of a cell is divided into two nuclei with a...

Q: how do you explain behavior using brain dynamics?

A: The "nervous system", also known as the neural system, is a complicated network of neurons that are ...

Q: What are the conditions that might cause a cell to halt the cell cycle

A: Introduction: A cell cycle is a set of events that occur in a cell as it divides and grows. A cell s...

Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...

A: Answer C --118mEq/L

Q: Which of these is likely to reduce enzyme activity? Increasing pH level II. Decreasing temperature I...

A: Introduction Enzyme activity:- Enzyme activity is the amount of substrate converted by the enzyme in...

Q: Describe how the two strands of DNA are oriented with respect to each other.

A: DNA stands for deoxyribonucleic acid and is a type of nucleic acid. Except for a few organisms, DNA ...

Q: Refer to question 5. Assuming complete dominance, the F2 generation will show a phenotypic ratio of_...

A: Complete dominance: Diploid organisms frequently carry two alleles of a gene in the most extreme cir...

Q: In plants, the transition from water to land most likely happened once twice: ones in the moss linea...

A: The difficulties that the primary land plants needed to defeat going limp in land from gravity, the ...

Q: Indicate your answer by writing Y if a characteristic and N if a non-characteristic. If the characte...

A: Eukaryotic organisms have well-developed nuclei surrounded by nuclear membrane while prokaryotes do ...

Q: The enzymes BamH I and Bal II recognise different sequences but leave the same sticky ends: BamH I: ...

A: Restriction enzymes or endonucleases are enzymes that recognise particular DNA sequences at the rest...

Q: Acetylcholine: is the neurotransmitter in the parasympathetic nervous system. is the neurotransmitte...

A: Introduction: acetylcholine is a neurotransmitter, it is an ester of choline and acetic acid. acts a...

Q: What features do mature eukaryotic mRNA molecules have that bacterial mRNAs lack?

A: The process associated with the formation of mRNA (messenger ribonucleic acid) from DNA (deoxyribonu...

Q: 7. Use the image to answer the following questions A student collects some of this bacteria to creat...

A: Answer 1:-  Based on the microbiological examination of the slide shown in the question, the petri d...

Q: The electron-transport chain consists of a number of multi protein complexes, which work in conjunct...

A: Introduction  FADH and NADH are examples of electron carrier which takes part in most of the redox b...

Q: _____ are characteristic of cancer. a. Malignant cells b. Neoplasms c. Tumors

A: Introduction :- Cancer is a disease that occurs when cells divide uncontrollably and spread into nea...

Q: Complete the table below. Globular Fibrous Uses Solubility Number and type of amino acids Structure

A: The complete table attached below. This scenario based on two types of protein fibrous and globular ...

Q: Explain comprehensively. a.  How does evolution play a role in meiosis and sexual reproduction? b....

A:

Q: Which precedes an action potential traveling down the axon of a neuron? A. Neurotransmitters bind to...

A: The right Answer is A

Violence

Violence is defined as a physical act that causes or is intended to cause harm. Violence can cause physical, emotional, or both types of harm. Violence is defined by the World Health Organization as the intended use of physical force and power that causes threat or harm against oneself, another person, or against a community or group, and has the potential to cause damage, death, mental distress, maldevelopment, or poverty.