Which statement is true about an algorithm?Select one:O a. Each step in an algorithm should accomplish everything needed for a subtask.O b. While order of steps in an algorithm might not be critical, they should be carried out in the order they are writtensequentially unless the structure indicates branch or repeat.O c. The tasks of an algorithm should be independent such that they can be carried out simultaneously to increasethroughput.Od. The steps in an algorithm can be executed in any order, as long as they are executed

Answered: Image /qna-images/answer/c189f8b3-0025-4807-a469-decea341c132.jpg

Which statement is true about an algorithm? Select one: O a. Each step in an algorithm should accomplish everything needed for a subtask. O b. While order of steps in an algorithm might not be critical, they should be carried out in the order they are writter sequentially unless the structure indicates branch or repeat. O c. The tasks of an algorithm should be independent such that they can be carried out simultaneously to increase throughput. O d. The steps in an algorithm can be executed in any order, as long as they are executed

Which statement is true about an algorithm? Select one: O a. Each step in an algorithm should accomplish everything needed for a subtask. O b. While order of steps in an algorithm might not be critical, they should be carried out in the order they are writter sequentially unless the structure indicates branch or repeat. O c. The tasks of an algorithm should be independent such that they can be carried out simultaneously to increase throughput. O d. The steps in an algorithm can be executed in any order, as long as they are executed

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Question 4 - Algorithm Design Imagine you are a treasure hunter standing at one side of the river. There are n (a positive integer) stones on the river. They are aligned on a straight line and at the nth stone, there is treasure waiting for you. Your target is to reach the nth stone. For each move, you have the choice of either walking (move one stone ahead) or leaping (move two stones ahead). Also, you are not allowed to travel backwards. Design an algorithm that calculates the number of ways (sequences of walks/leaps) that get you to the treasure stone. You should clearly explain the algorithm and demonstrate the correctness of the algorithm with a complete proof. Here is an example. For n = 1 5, there are 8 ways: Method 1: walk → walk → walk → walk → walk Method 2: walk → walk → walk → leap Method 3: walk → walk → leap → walk Method 4: walk → leap → walk → walk walk Method 5: leap → walk → walk → Method 6: leap → leap walk Method 7: leap → walk → leap Method 8: walk → leap leap
An algorithm that has been meticulously planned out should have no room for ambiguity.
Vocabulary Task (C language) Natural language processing (NLP) is a field of artificial intelligence that seeks to develop the ability of a computer program to understand human language. Usually, the first step of an NLP system is to convert words into numeric codes. Thus, the system converts an input text into a sequence of numeric codes before any high-level analysis. This process is known as text preprocessing. We can only perform text preprocessing if we have a vocabulary of words and their associated numeric codes. Your task is to create a vocabulary of unique words for a given text file and assign a different number from 1 to N to each unique word, with N being the total number of unique words. You must perform this assignment so that the first word in alphabetical order gets the number 1, the second word in alphabetical order gets the number 2, and so on. A word is a sequence of letters (uppercase or lowercase). The file is composed of letters and white spaces (spaces, tabs,…
When explaining an algorithm, it is critical to emphasise its strengths.
1. Construct the flow chart of this algorithm. 2. Write well-structured pseudocode to implement this algorithm.
37. Algorithms X and Y each solve the same problem, but X always runs faster. Which assertion applies for the algorithms? A.Algorithm Y is incorrect. B.Algorithm X is more time-efficient than Y. C.Algorithm Y is more time-efficient than X.
Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACT
algorithms are solely theoretical for a and b. please number the steps of the algorithm, thank you
____ is the simplification of an algorithm’s runtime to its greatest term, giving us a function that describes the functions worst case relative growth.
3. Having an idea of what an algorithm is, cite at least 3 instances wherein you can apply it to BS BIOLOGY course and briefly explain how.
Computer Science Writing a Java Algorithm program or Python Algorithm program is optional and flowchart Must produce an algorithm as a narrative set of instructions using programming language concepts, in pseudo-code style format. So a person given the inventory of pieces and your algorithm would produce a finished product. i.e. a closed circuit.
5. Algorithms can be created in all the following ways EXCEPT: A. creating from an idea B. combining existing algorithms C. removing sequencing, selection, and iteration from an algorithm D. modifying existing algorithms