Which one of the following statements is true? Select one: O a. It takes three genes to code for one protein O b. Each amino acid in a protein is coded for by three bases in the DNA O c. Each gene codes for three proteins O d. Each DNA base codes for three amino acids O e. Each triplet has many different meanings

Which one of the following statements is true? Select one: O a. It takes three genes to code for one protein O b. Each amino acid in a protein is coded for by three bases in the DNA O c. Each gene codes for three proteins O d. Each DNA base codes for three amino acids O e. Each triplet has many different meanings

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 3VCQ: Figure 14.21 A fr am eshift mutation that results in the insertion of three nucleotides is often...

See similar textbooks

Similar questions

CHu e Gene DNA IDeyrboruic Acaj How are these proteins made in a cell? For starters, the instructions for making proteins are "written" in a cell's DNA in the form of genes. 2. In your own words, define a gene.
of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acids
3. In studying normal and mutant forms of a particularhuman enzyme, a geneticist came across a particularly interesting mutant form of the enzyme. Thenormal enzyme is 227 amino acids long, but themutant form was 312 amino acids long. The extra85 amino acids occurred as a block in the middleof the normal sequence. The inserted amino acidsdo not correspond in any way to the normal proteinsequence. What are possible explanations forthis phenomenon? How would you distinguishamong them?
What is the nucleotide sequence of the complementary strand of this DNA molecule A TGCGA? CATAG O A AT G CGA O TACG CT CCGTTAT
. While perusing the E. coli K12 genome sequence,you come across a gene with no known function. Theamino acid sequence of the gene’s protein productshows weak similarities with known porins, proteinsthat cross a cellular membrane to let molecules suchas amino acid or sugar nutrients (or drugs like penicillin) pass through. Some porins are nonspecific and letany solute up to a certain size transit into the cell.Other porins are specific and allow the transit ofcertain sugars but not others. What genetic experiments could you do to try to determine whether thisnew gene has a specific function in allowing bacterialcells to scavenge the sugar maltose from the environment? Describe scenarios that might complicate yourexperimental approach.
A particular triplet of bases in the coding sequence of a DNA strand is AGT. What is the corresponding triplet in the complementary strand of 2 points DNA? O AGT О ТСА O UCA O UGT Poovor tf ho coulLfind the ler Gregor Mondolcovnorimontc couab 9MO
3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T ACGCGTATACCGACATTC MRNA: Codon: Anitcodon: Amino Acids: A8m Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: CGAT ACAATGGACCCGGTATGCGATATCC DATAA
DNA 11. A A A U C MRNA 12. 13. TRNA Amino Acids 14. Aзparagine 15. lor 3 codonas equal one aminoacid? 16. RNA brings amino acids to the nucleus orribosome? 17. A polypeptide is a sequence of proteins or aminoacid:? 18. RNA has codons or anti-codons? 19. RNA transfers amino acids during trauslationbetranscrintion? 20. Ribosomes are the site where translationor transcription takesplace? DNA 21. © A T 22. (A G MRNA 23. ERNA Amino Acids 24. Stop FOo -0- FO- -0- Foo- FOo- Fo- FO-
A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAAWhich of the following mutations would cause a missense mutation in the sequence shown above? Select one: a. Replacement of second thymine base with cytosine base b. Replacement of second guanine base with thymine base c. Replacement of last adenine base with guanine base d. Replacement of first guanine base with adenine base
€ 2 A X 1_30*_SP23 - General Biology I (for majors)/11 f us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: a. AUGCCCCGACUCUAA O b. Met-Pro-Arg-Leu-STOP O c. UACGGGGCUGAGAUU O d. Tyr-Gly-Ala-Glu-lle 20 000 MacBook Air DII
If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand would be O AGUC. O ATGC. O TCAG. O TGAC. O AGTC. PRINECOMAS pptx PRINECOMA3 . pptx MacBook Air 888 F3 %23 %24 & 2 4 W R Y F K C. V M mand com V