Which of the following will have an electron configuration ending with 4p? Choose ALL that apply. d. Rubidium Atom a. Bromide lon b. Bromine Atom c. Krypton Atom e. Rubidium lon f. Selenide lon

Q: Classify the type of lipid shown here. A) fatty acid B) steroid C) wax D) triglyceride

A: The three main types of lipids are phospholipids, sterols, and triacylglycerols (also known as…

Q: 17. Shown below is the generic structure of an amino acid. Amino acids undergo polymerization…

A: An organic compound that contains an alpha-COOH and alpha-NH2 functional groups is called amino…

Q: com X The folding of a protein is a complex and random process. Real Fake ê Abrir en Google…

A: A) Real    The folding of a protein is a complex and random process

Q: QUESTION 55 The likelihood that the longer elution times (Rf) were due to the following: O The more…

A: As per our guidelines, I can answer only first question. Because you have posted multiple questions.…

Q: Define captopril ?

A: Captopril is a drug used to treat high blood pressure and congestive heart failure. Its IUPAC name…

Q: Q1) Define terms polymers, elastomers, and synthetic fiber. Also explain in detail the industries…

A: Solution - Polymers - A polymer is  class of natural or synthetic substances which is  made up of…

Q: What structural features make polymer to be thermo and thermosetting polymers? Explain with one…

A:

Q: Most ring fusions in a steroid molecule are: Cis Parallel Trans Anti

A: Steroid molecules generally have a four fused cycloalkane rings. For example cholesterol.

Q: Consider the tripeptide phenylalanylcysteylmethionine. Part: 0/2 Part 1 of 2 Draw the structure of…

A: Peptide structures are written in such a way that left side is N-terminal while right side is…

Q: In polarimetry when lactic acid measured was contaminated with glycerol, what happens to the…

A:

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Using alanine as an example, draw possible conformations of alanine in a peptide chain (Ala-Met-Thr)…

A:

Q: 1. Draw 2D chemical representations of atactic, syndiotactic, and isotactic polystyrene. 2.…

A: First  three question answered below:

Q: The monomers NH2 and HO-C (CH FOH would react with each other to form a polyamide a polycarbonate a…

A:

Q: Is there commerical resin similar to RP-46 polyimide resin?

A: Ans:  widely used thermoset polyimide resin comprises PMR-15 and RP-46

Q: 1-proteins-lab-manual?module_item_id=44333 A= abc Where "A" is absorbance, "a" is molar…

A: First question had been answered. Absorbance of a solution can be calculated using Beer Lambert law.

Q: At what pH will the following tripeptide have this structure? H2N-CH- -CH-C- N-CH-C-OH CH2 CH-OH CH2…

A:

Q: acid) of the polymeric chains to produce large and narrow size porous structure, respectively.

A:

Q: (k) dendrimer (1) engineering plastic (m) elastomer (n) end group (o) graft copolymer

A: A polymer is a large molecule composed of repeating units called monomers.

Q: How does polyimides behave in acidic media?

A: The polymer of the imide monomers that belongs to class of the high performance plastics are known…

Q: + NaOCH₂

A: Robinson annulation: The given reaction is an example of Robinson's annulation reaction. In this…

Q: How many fused rings are there in steriod?

A:

Q: Refer to the given figure below. Peptide and protein synthesis in the body occurs at the ribosome.…

A: Elimination reactions are those in which a substance is eliminated during the course of the…

Q: What is the difference between dry and wet milling of starch? Which method is given more preference…

A: The dry milling and wet milling are important methods of processing. Distinct co-products are…

Q: Demonstration: the specimens shown are (a) a piece of cured epoxy resin, (b) a rubber band, and (c)…

A: Thermosets are polymers in which a cross-linking reaction which occurs. It promotes the chemical…

Q: new synthetic fibres in the last 15 years in the fibre industry? their chemistry their usuage

A: Synthetic fibres are fibres that are man-made through chemical processes. Some of its examples are…

Q: 2. a. Which amino acid is this? (might need to look at another amino acid b. Label which of these is…

A:

Q: Fill in the side chains (including stereochemistry) on the dipeptide backbone below to make the…

A: All the amino acids exhibit L-stereochemistry except glycine.

Q: n one. Match enzyme or molecule with its function in bacteria. Answers may be used more than once or…

A: 37. RNA polymerase is the main enzyme in catalyzing DNA→ mRNA transcription.  38. DNA helicase…

Q: what is pseudo order treatment

A: Pseudo is Latin word which means ‘fake’. A Pseudo order reaction can be defined as a bimolecular…

Q: Sketch the structure of a tripeptide composed of D-glucose, D-mannose, and D-galactose (in that…

A: Tripeptide are essentially consists of three amino acids which are linked together by forming to…

Q: A. Circle the peptide bond in this structure. H3N CH- - ܬܐܐܐ || - H N-CH-C-0 CH3

A: A peptide bond, also referred to as an amide bond, is formed between the α-nitrogen atom of one…

Q: High-density polyethylene (HDPE) fibre is used as liners for surgical gloves. Although the liner has…

A:

Q: Hyaluronate in the cartilage acts as a: repeating unit of the aggrecan molecule. central filament…

A: Hyaluronate in the cartilage acts as a central filament between  glycosaminoglycans It is present…

Q: Intermolecular chain transfer R R- MLn MLn P. R Intramolecular chain transfer Ring-Opening…

A:

Q: Why can't chemical recycling–that is, the conversion of polymer to monomers and reconversion of…

A: In the preparation of low density polythene, very high pressure is required which is around 1000 to…

Q: Biological Macromolecules Identifying and drawing peptide bonds Draw the structure of…

A: If the pH is greater than pKa then deprotonation occurs and it exists in deprotonation form. While…

Q: Discuss the potential impact of polymorphism on the physicochemical properties of drugs.

A: The potential impact of polymorphism on the physicochemical properties of drugs are

Q: Which statement best explains the chemical differencesbetween DNA and RNA? (a) DNA has two different…

A: DNA and RNA are nucleic acids, that are important for the storage of genetic information and…

Quantum Chemistry

Quantum chemistry deals with the properties of chemical systems and their reactions. The branch of chemistry which is more concerned with quantum chemistry is physical chemistry. It is a more sophisticated field of theoretical physics which is concerned towards the application of physical concepts towards various chemical aspects such as, formation of atoms, chemical structure descriptions, chemical bond strength, hybridization, conjugation etc. Quantum chemistry mainly studies the various states i.e., ground state, excited state, transition states of the individual atoms or molecules taking place during any chemical reaction. The laws of motion explained by various scientists, which are termed as “classical mechanics” were not acceptable in terms of electrons, protons, atoms, light etc. Thus, a new theory named “quantum mechanics” emerged to understand the basic framework of various atomic and subatomic particles.