Which of the following RNA molecules is responsible for carrying the code that will be read at the ribosome in order to create protein?

Q: Which of the following step acts before the others in pro ribosome large subunits binds to mRNA TRNA…

A: The translation process completes in three main steps. they are initiation, elongation, and…

Q: The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA…

A: The given amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly.  3…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: To begin translation, the small subunit of the ribosome starts moving down an mRNA.  What feature…

A: INTRODUCTION Translation  Translation is the process of conversion of mRNA into protein. It consist…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Why may tRNA be considered the “interpreter” of the genetic code?

A: Introduction: RNA is a type of nucleic acid that is a genetic material in some viruses. There are…

Q: Explain the steps of RNA translation into protein.

A: “Since you have posted multiple questions, we will provide the solutiononly to the first question as…

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and…

A: RNA or ribonucleic acid is a molecule which play a significant role in expression of genes via…

Q: Which of the following sentences is INCORRECT: The aminoacyl TRNA synthetase charge O the TRNA…

A: tRNA is a type of RNA molecule that helps decode a messenger RNA sequence into proteins. tRNA has…

Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…

A: BASIC INFORMATION  TRANSCRIPTION  it is responsible for the formation of hnRNA which has the codes…

Q: Give the initiation codon for protein synthesis. Name the amino acid it codes for?

A: A genetic codon is a three-nucleotide sequence of either DNA or RNA that corresponds to a particular…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Suppose the gene that produced this mRNA happens to mutate so that one of the codons in the middle…

A: Nucleic acids are the carrier of genetic information in the cells. DNA is the carrier of genetic…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…

A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…

Q: Indicate whether there is matching (1) or base complementarity (2) between the following nucleic…

A: The template strand is also called antisense strand.  Biosynthesis of mRNA using antisense strand of…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: stimulating

A: The double stranded DNA contain the Nitrogenous bases on the strands . Transcription of the sequence…

Q: Which of the following is the first step of translation in a eukaryotic cell? a RNA containing…

A: Translation is the process of protein synthesis which is done by ribosomes.

Q: Messenger RNA Iis single-stranded molecule while RNA and rRNA molecules are double-stranded…

A: Ribonucleic acid (RNA) is a biomolecule that takes part in a wide array of biological roles.

Q: Describe the process where a peptide chain is formen from a code embedded in a nucleic acid…

A: Central Dogma of molecular Biology explain how a DNA replication result into DNA, DNA is changed…

Q: Name all components you would find in a fully assembled ribosome during elongation of protein…

A: Protein synthesis or translation consists of three stages - initiation, elongation and termination.…

Q: diagram shows a pre essing. present that splicing bind here. What components of this transcript will…

A: Introduction Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in…

Q: In how many cases in the genetic code would it NOT be possible to know the amino acid specified by a…

A: DNA or deoxyribonucleic acid is a double-helical molecule consisting of two polynucleotide chains.…

Q: Put the following events involved with protein synthesis in order. Move first event to the top of…

A:

Q: What is the mRNA strand of the following DNA (coding) strand: ATGGCTAACCTTGTA

A: Gene expression is the process through which data from a gene is employed in the synthesis of a…

Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…

A: The cells are the basic biological structural and functional units of life. These cells of the body…

Q: Write the standard base sequence of the messenger RNA that would cause a ribosome to make the…

A: The amino acids in the protein are placed in the order from N-terminus to C- terminus. The mRNA are…

Q: In the normal course of events within protein synthesis, which of the following is part of, or cal…

A: The tRNA molecule has a distinctive folded structure with three hairpin loops that form the shape of…

Q: Which of the following RNAs are required for translation? (Choose all that apply) tRNA rRNA…

A: Adenine, guanine, cytosine, and uracil make up RNA, which is a polymer of nucleotides composed of a…

Q: Describe how an Rna molecule is translated into a protein at the ribosome

A: The process of synthesis of protein from RNA is known as translation and occurs within a specialized…

Q: list all the steps required for mRNA to be translated into a protein

A: The process by which genetic information encoded in messenger RNA (mRNA) is converted into a…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.