Which of the following RNA molecules is responsible for carrying the code that will be read at the ribosome in order to create protein?

Q: The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA…

A: The given amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly.  3…

Q: List the order in which the A, P, and E sites of a ribosome are occupied by an amino acid.

A: Translation is defined as converting the messenger RNA or mRNA produced during transcription process…

Q: In a detailed diagram show and explain all the locations where RNA may regulate protein translation.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: RNA Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Eukaryotic primary transcripts are split. That is, they are composed of coding sequences for…

Q: To begin translation, the small subunit of the ribosome starts moving down an mRNA.  What feature…

A: INTRODUCTION Translation  Translation is the process of conversion of mRNA into protein. It consist…

Q: A gene normally contains an N' terminal ER signal sequence and an internal stop transfer sequence.…

A: Answer :- Option (A) are the best represents the orientation of the protein product after…

Q: Define messenger ribonucleic acid (mRNA)

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: Choose the answer that has these events of protein synthesis in the proper sequence. (Note some…

A: The steps of Protein synthesis are collectively  called translation it involves forming proteins…

Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…

A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…

Q: At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and…

A: RNA or ribonucleic acid is a molecule which play a significant role in expression of genes via…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Which of the following sentences is INCORRECT: The aminoacyl TRNA synthetase charge O the TRNA…

A: tRNA is a type of RNA molecule that helps decode a messenger RNA sequence into proteins. tRNA has…

Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…

A: BASIC INFORMATION  TRANSCRIPTION  it is responsible for the formation of hnRNA which has the codes…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Why exosome complex destroys the mRNA ?

A: Exosomes are defined as vesicles which are nano metric-sized, being packed as biomolecules ranging…

Q: Which type of RNA serves as the genetic template (blueprint) utilized by the ribosome during the…

A: Rna is ribonucleic acids which are formed by ribonucleotides .

Q: Which of the following is the first step of translation in a eukaryotic cell? a RNA containing…

A: Translation is the process of protein synthesis which is done by ribosomes.

Q: What distinguishes proteins that will be released into the cytoplasm after translation from proteins…

A: Protein synthesised in cytoplasm enters the endoplasmic reticulum via pores and is modified there.…

Q: The initial step in the protein translation is described by: O release of the initiation factors…

A: There are 4 Biomacromolecules. They are ; Proteins Nucleic acids Carbohydrates and  Lipids

Q: diagram shows a pre essing. present that splicing bind here. What components of this transcript will…

A: Introduction Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in…

Q: Put the following events involved with protein synthesis in order. Move first event to the top of…

A:

Q: State the direction of movement of the ribosome along the mRNA strand (the direction of…

A: Protein synthesis involves translation of mRNA into protein that requires three complex stages:…

Q: ist several ways in which eukaryotic messenger RNA differs from prokaryotic mRNA.

A: messenger RNA or m RNA is the RNA formed during the transcription process from DNA. The enzyme used…

Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…

A: The cells are the basic biological structural and functional units of life. These cells of the body…

Q: Write the standard base sequence of the messenger RNA that would cause a ribosome to make the…

A: The amino acids in the protein are placed in the order from N-terminus to C- terminus. The mRNA are…

Q: Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would…

A: The objective of the question is to determine the sequence of amino acids that would result from the…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: Describe how an Rna molecule is translated into a protein at the ribosome

A: The process of synthesis of protein from RNA is known as translation and occurs within a specialized…

Q: If methionine is the first amino acid incorporated into a heptapeptide, what is the sequenc of the…

A: Each group of three bases in a mRNA constitutes a codon. Each codon specifies an amino acid.

Q: Which of the following is responsible for creating the covalent bonds that link the amino acids of a…

A: RNA stands for ribonucleic acid which plays a key role in the metabolic processes for all steps of…

Q: A mutation in DNA generates a aUGA stop codon in the middle of the mRNA coding for a particular…

A: A gene is a nucleotide sequence in the genome that codes for a functional molecule. The gene's DNA…

Q: Messenger RNA is single-stranded molecule while tRNA and rRNA molecules are double-stranded…

A: massanger RNA (mRNA) molecules convey the coding successions for protein union and are called…

Q: Which enzyme is responsible for "charging" RNAS with the correct amino acid?

A:

Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…

A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…

Q: What is the one-letter amino acid sequence formed from the following mRNA that codes for a…

A: Nucleic acid is a macromolecule which play important role in storage of genetic material and…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.