Answered: Which of the following factors…

Which of the following factors stabilizes population growth into an S-shaped curve? a. limited territory b. a low number of predators c. abundant food d. stable water temperature

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter40: Population Ecology

Section: Chapter Questions

Problem 6SA: _______ is a density-independent factor that influences population growth. a. Resource competition...

See similar textbooks

Related questions

Q: Annotation of the human genome sequence reveals a discrepancybetween the number of protein-coding…

A: Introduction Initially it was assumed that humans would have nearly 1lacs genes as these many genes…

Q: The width of the mouth is equal to three times the vertical height of the eyes twice the width of…

A: Introduction Mouth, additionally called oral cavity or buccal cavity, in human life…

Q: List the derived traits in the angiosperm that make it MOST adapted to life on land, and describe…

A: Angiosperms are also known as “flowering plants”. The majority of plants on Earth are angiosperms,…

Q: 15. Antibiotics provide the best defense against viruses a. b. True a. b. False 16. Cocci bacteria…

A: Introduction Small, single-celled organisms are known as bacteria. Nearly all areas of the planet…

Q: Fully explain and differentiate between the processes of aerobic respiration, anaerobic respiration…

A: Introduction Anaerobic respiration and fermentation serve as alternative glucose breakdown pathways…

Q: Jaundice fluid is classified as a cavity fluid. a supplemental arterial fluid. a standard arterial…

A: Jaundice is a medical condition in which bilirubin and biliverdin levels are abnormally high. This…

Q: Utilize the attached picture. She leads with her right leg. A. What motion is occurring in the left…

A: 1.Answer : Motion occurring in the left knee from A to B is flexion .Beacuse in the picture angle…

Q: A scientist sequencing mRNA identifies the following strand:…

A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…

Q: Why inoculate from just a single colony?

A: A microbiological culture, also known as a microbial culture, is a technique for growing organisms…

Q: During gametogenesis, from a single germ cell (oocyte/spermatocyte), males produce. O4;1 4:4 O1;1…

A: ANSWER) Gametogenesis is the process by which oocytes and spermatocytes produces gametes. More male…

Q: Which of the following occurs to the blastocoel during Xenopus development? is replaced by the…

A: Xenopus It refers to the genus of highly aquatic frogs that are mostly found in the regions of…

Q: . What is science ? A. Study of living things B. study of nature C. Study of law D. All of the above

Q: . Critically evaluate the role and reliability of different diagnostic methods in use for difficult…

A: I will be answering the above question by taking Infective endocarditis(IE) as an example:- IE is a…

Q: The result Jack obtained after transforming his competent Escherichia coli cells with plasmids is as…

A: Plasmid It is small, circular, and double-stranded DNA that is found in bacterial cells and in some…

Q: genotypes and phenotypes

A: Genotype: The genetic make up of an individual is called as the genotype. Example: Eye colour.…

Q: Explain how the following factors affect the blood velocity and volume flow rate as well as…

A: Stroke is a medical emergency that occurs when the blood flow to the brain is interrupted. This can…

Q: Linear evolution suggests that there is a ladder, or step- progression, to evolution over time one…

A: The pre-Darwinian theories established by Aristotle, when species were believed to be static…

Q: Determine the phenotypes of grande and petite yeast cells with respect to the extraction of cell…

A: In the realm of genetics, Saccharomyces cerevisiae, also known as the bread mould, is actively…

Q: Cleft lip and cleft palate can be a devastating congenital disorder. Please explain why this…

A: A congenital disorder is an inherited medical disorder that occurs in a baby at or before birth.…

Q: Determine the appropriate bacterial strain that can be allowed to mate with the strain that is…

A: An organism's genotype is influenced by its genome as well as by its environment. It is not as…

Q: What are the key features of the early and late asthmatic responses?

A: In asthma, both hyperactivity and inflammation of the airways result in a chronic lung disease. An…

Q: 3. Linear evolution suggests that there is a ladder, or step- progression, to evolution over time --…

A: Evolutionary developmental biology is considered a new norm in evolutionary biology. It arose from…

Q: So yes?

A: Restriction enzyme that cuts double-stranded DNA into fragments after recognizing specific…

Q: Identify the site of ribosomal subunit assembly

A: The ribosome is a macromolecular assembly that is involved in the synthesis or translation of…

Q: In DNA amplification, using the Taq polymerase, what is the maximum number of amplification cycles?…

A: Introduction In the field of molecular biology, however, cloning is viewed at a genetic molecular…

Q: Hame Aal@yah, M. How to Use Microscope and parts-The microscope you will use in bic microscope. It…

A: We may also use use a stereoscope which is used to view stereoscopic pair of separate images, as a…

Q: What are molecular clocks used for, what specific information is needed to utilize molecular clocks…

A: The molecular clock counts the number of random mutations that occur at a comparatively constant…

Q: Question 1 Which structure is correctly paired with its tissue system? root hair-vascular tissue…

A: Vascular tissues are complex conducting tissues in higher plants made up of various cell and element…

Q: when you eat food that contains carbohydrates you break down the carbohydrates into a…

A: Carbohydrates is a biomolecule which is consisting of hydrogen, oxygen and carbon. It is one of the…

Q: Question 33 (1 point) ✓ Saved Which of the following reactions is catalyzed by carbonic anhydrase?…

Q: ➤ Question 22 3 points Save Answer A plant has the following characteristics: a taproot system,…

A: Introduction The kingdom Plantae contains eukaryotes that are mostly photosynthetic. Algae and…

Q: Which suite of reproductive features distinguishes angiosperms from gymnosperms? A. The carpel,…

Q: Would gram negative or gram positive bacteria have an advantage over the other in these tonicities?…

A: A lipopolysaccharide-containing outer membrane surrounds the peptidoglycan cell wall that encases…

Q: Fever can indicate that a. the pathogen remains on the skin D. the body is responding to an…

A: Normal temperature of the body is 98.6 degree fahrenheit. Fever occurs when this temperature rises.

Q: A cross between guinea pigs with curly black hair with whites of smooth hair, gave in F1 100%…

A: The genotype is a set of a gene in DNA that is responsible for unique traits or characteristics.…

Q: how are microorganisms are involved in the production of lagers?

A: Introduction: Lager is a beer that has been combined and shaped at a low temperature. Lagers come in…

Q: What is the impact of lianas on tree biomass

A: Lianas, often known as woody vines, are a varied group of woody climbing plants. Lianas employ trees…

Q: How do the bladder and urethra function in urine regulation?

A: In the urinary system, blood is filtered and urine is formed as a waste by-product. A urinary system…

Q: How many different cell types are found in the human body?

A: There are trillions of different types and sizes of cells in the human body. These incredibly small…

Q: 1) The primary means of sustaining a competitive advantage is to adjust faster to the environment…

A: Introduction Competitive advantage refers to the ability of an organisation to serve more…

Q: Write an expression to describe the amount of energy, x, a tertiary consumer receives from a…

A: Introduction :- Those who consume secondary consumers are referred to as tertiary consumers (large…

Q: Is omicron deadly

A: Introduction The novel coronavirus SARS-CoV-2, which first appeared in Wuhan, China in 2019, and…

Q: Scientists found that different beak shapes correlate with different mating songs in Darwin's…

A: Introduction: Although he was unaware of it at the time, Charles Darwin's arrival in the Galapagos…

Q: Question 11 For the following statement, decide whether it is true or false and provide a…

A: Introduction Plants are autotrophs which means they can produce their own food, they do so by the…

Q: Imagine that you wanted to know if speciation rate in plant groups is linked to whether the plants…

A: Answer- Correct option is (A) Pollination is transfer of pollengrains from the anther of one flower…

Q: Please explain the outcomes of nondisjunction in meiosis one versus nondisjunction in meiosis two,…

A: Introduction Meiosis is the reductional division as it involves the formation of 4 daughter cells…

Q: Explain the full progression of blood gas abnormalities in a severe asthma attack.

A: Asthma Is a chronic lung disease characterised by bronchial inflammation &…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: Describe the process of oxyhemoglobin association and dissociation.

A: Oxyhemoglobin is the hemoglobin bound to oxygen. There is a dynamic relation between the binding of…

Q: C. Male Organs Select the structures described by the statements below. bulbourethral gland corpora…

A: There are several sex organs in the male reproductive system which are involved in human…

Concept explainers

Communities and Ecosystems

Ecology contains two words: Eikos means dwelling, and logy means to study, so the combined meaning is studying habitat or living.

Question

Which of the following factors stabilizes population growth into an S-shaped curve?

limited territory

a low number of predators

abundant food

stable water temperature

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

When r is a positive number, the population size is (a) stable (b) increasing (c) decreasing (d) either increasing or decreasing, depending on interference competition (e) either increasing or stable, depending on whether the species is semelparous
The per capita growth rate of a population where dispersal is not a factor is expressed as (a) i + e (b) b d (c) dN/dt (d) rN(K N) (e) (K N) K
Population _______________ is the number of individuals of a species per unit of habitat area or volume at a given time. (a) dispersion (b) density (c) survivorship (d) age structure (e) demographics
_______ is a density-independent factor that influences population growth. a. Resource competition c. Predation b. Infectious disease d. Harsh weather
Figure 19.6 If the major food source of seals declines due to pollution or overfishing, which of the following would likely occur? a. The carrying capacity of seals would decrease, as would the seal population. b. The carrying capacity of seals would decrease, but the seal population would remain the same. c. The number of seal deaths would increase, but the number of births would also increase, so the population size would remain the same. d. The carrying capacity of seals would remain the same, but the population of seals would decrease.
Below is a table that shows the changes in a population of domesticated rabbits. What is the most likely explanation for why size of the rabbit population remained relatively constant from 1990-1992? Year 1986 1987 1988 1989 1990 1991 1992 Population 601 732 769 800 816 815 816 O a. The population suffered from a new disease O b. A new predator was introduced c. The rabbit's prey source was killed off due to hunting o d. The population reached its carrying capacity
Which of the following would not be an example of density-deperident factors regulating population size? The number of possible territories for robins is limited; thus when population sizes are high, a lower proportion of individuals can produce offspring. A. O B. In conditions of overcrowding, some desert pupfish living in ponds will emigrate to other ponds if given the opportunity. C.Predation on mosquitofish is high, regardless of population size. D. In conditions of high density, mice are more susceptible to mortality from heat stress. E. In a habitat patch with a high density of muskrats, a disease spreads more rapidly and results in higher mortality.
Which of the following factors is MOST LIKELY to have a density-independent influence on population growth? O a. availability of shelter b. all of these Oc. infectious diseases O d. extreme weather conditions e. abudance of prey
Fly Population 4. The graph below represents the growth of a population of flies in a jar. Which letter(s) indicates the part of the graph where biotic potential is the only thing affecting the population? Choose all letters that apply. B Days 5. A population of mice has grown so rapidly that there are 2,400 individuals in an ecosystem that will support about 1,800 mice. The mouse population is most likely to A. undergo a decline in size, possibly to a stable level at or below 1,800 individuals B. have no effect on the population size of predators that feed on mice C. continue to have a birth rate that equals the death rate D. continue to increase 6. A population will always grow exponentially A. if it is limited only by density dependent factors. B. if there are no limiting factors C. if it shows logistical growth Number of Aes
In this graph, the prey and predator populations periodically increase and decrease. This is an Prey Predator example of which type of population growth? Time A. exponential B. logistic C. stable D. cyclical Number
ASAP
Which of the following is true of overexploitation? Select ALL that apply. a Only animals are affected by overexploitation. b Overfishing is due to modern fishing techniques that can take a lot of fish at once. c Amphibians are overexploited for food, medicine, and research. d Overexploitation means harvesting species at a rate slower than the population can recover. e Many birds are overcollected for the pet trade.