Which of the following CHÍNH, CH HO CHÁNH, CH₂OH I CH H₂N both a and b neither a nor b CHÍNH
Q: Explain the Role of telomere in regards to cancer
A: Telomeres gradually shorten with each cell division, resulting in less protection for the…
Q: Properties of Body Fluids.
A: "Since you have posted multiple questions, we will answer the first question for you. If you want…
Q: transmembrane portion of an alpha helix?
A: The alpha helix is a common motif in the secondary structure of proteins and it is a right…
Q: In your own words how are drugs and toxins can have direct and indirect stimulation of the motor…
A: Toxins and drugs are a conceivable and prevalent significant public health problem, but they…
Q: ______ 1. is the name of the enzyme that catalyzes the hydration of carbon dioxide to bicarbonate…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. The CO2 formed in the…
Q: We use 3.16 fold dilution why this dilution schedule is important to determine unknown DNA…
A: The dilutions are the geometric series i.e Serial dilutions are prepared using same dilution step as…
Q: How can studying Proteins and amino acids answer the question "what is life?"?
A: We say that a Cell is a basic structural and functional unit of life. This cell is made up of…
Q: The Problem The three diseases in this study are borne out of errors that involve certain…
A: Introduction: Fumarase deficiency is a rare autosomal recessive metabolic disorder characterized by…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: The reason for the decrease in the rate of enzyme reaction as the temperature is increased beyond…
A: An enzyme is a substance which serves as a catalyst in living things, governing the rate of chemical…
Q: How is it possible to maximize ethanol production using genetically modified yeasts?
A: A novel genetic engineering technique was used to make yeast more resistant to the negative effects…
Q: 7. The attachment of phosphoryl groups to specific amino acid residues is catalyzed by a) Diphteria…
A:
Q: Which of the two carbon sources, glucose or acetate, is more advantageous for the cultivation of…
A: E.coli - Escherichia coli, it requires a carbon source to grow to serve as substrate for the…
Q: What aeration condition (presence or absence of O2) favors cell growth? What is the metabolic…
A: Aeration means the presence of oxygen and anaerobic condition means the absence of oxygen. The…
Q: Which protein standard curve would you use to read off the protein concentration of an unknown…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. Protein's…
Q: Enumerate and discuss three disorders that could result from the absence of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Biological value
A: Protein efficiency ratio: It is defined as a ratio of weight gain of a subject to protein intake.…
Q: In a different instance of (d) two intants suspected to have a defi- ciency of the PDH complex…
A: During cellular respiration, respiratory substrates like glucose may undergo complete or…
Q: Categorize the electron carrier by the number of hydrogens that it can transfer in a single…
A: In the process of electron transport, one or more molecules accept electrons from another and donate…
Q: True or false Enzymes are not only proteinaceous in nature, but some RNA molecules such as ribozymes…
A: Enzymes are biological catalysts that accelerate chemical reactions.
Q: What is the nature of the DNA double helix? Are there other possible conformations of the double…
A: DNA which is acronym of deoxyribonucleic acid it is fundamental unit cell. It is composed of…
Q: The hydrolysis of a substrate, S, by an enzyme has been studied in the lab. The following initial…
A: Consider the reaction where a substrate 'S' is converted to its product 'P' by an enzyme. The rate…
Q: Write a possible mRNA base sequence that would lead to the production of this pentapeptide. (There…
A: mRNA is the abbreviation for messenger RNA, a type of single-stranded RNA involved in protein…
Q: 2. Draw out a labeled diagram explaining all the following processes: Gel Filtration Chromatography…
A: Gel Filtration Chromatography: Gel Filtration chromatography is method in which molecules in a…
Q: To establish a standard curve for a BSA standard curve using Bradford, the spectrophotometer…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: What are the two types of polysaccharides that are made up of starch?
A: Polysaccharide which is a type of carbohydrate contains long chain of polymeric carbohydrate which…
Q: The first step of gluconeogenesis takes place in mitochondria. Select one: O True False
A: Gluconeogenesis is a metabolic process that produces glucose from several non-carbohydrate carbon -…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that RNA structures are highly…
A: Introns are non-coding sequences, which are removed during the process of splicing. Splicing is…
Q: Total Number of NADH Obtained from one Pyruvate Molecule Total Number of FADH2 Obtained from one…
A: In respiring bacteria pyruvate is further oxidized after it is transported into mitochondria that is…
Q: Which of the following describes the correct order of energy conversions necessary to form…
A: Bioenergy is described as one of the most crucial resources that are available in order to meet the…
Q: Scenario IV. Electron Transport Chain Total Number of ATP Obtained from one Pyruvate Molecule Number…
A: Glucose or carbohydrates or sugars are oxidized through the process of glycolysis. Glycolysis occurs…
Q: + H2O NH + HCO,- NH, Urea a. =NH HN =NH HN H2O + HCO,- H2N `CO, H,N b. L-Histidine L-Histamine c.…
A: Hi. Thank you for the question, As per the honor code, we are allowed to answer three sub-parts at a…
Q: Enumerate foods from margaret's diet recall that fir these criteria. how do high carbohydrate diet…
A: Glucose is a monosaccharide and it is a simple sugar that is the most important source of energy…
Q: SCIENTIFIC PAPER INTRODUCTION ONLY- Titrimetric analysis of amino acids.
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They are composed of…
Q: Which of the following enzyme(s) is/are present in liver cells? () Glycogen phosphorylase (ii)…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Coenzyme A (CoA-SH) plays an important role in the Pyruvate Dehydrogenase Complex reactio Which is…
A: The pyruvate dehydrogenase complex is a mitochondrial multienzyme complex that catalyzes the…
Q: Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I.…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Does urinalysis prove the presence of disorder or disease? Explain
A: In many animals and humans, a liquid by-product of metabolism is urine. urine is…
Q: 5. With the presence of fast-food chains, many pcople have the opportunity to «have a quick bite»…
A: Fast foods are rich in carbohydrate, saturated fats and also contains some preservatives. Along with…
Q: How do you compare and contrast the structures between protein and carbohydrates?
A: Biomolecules are carbon-based organic compounds. Biomolecules are primarily made up of carbon,…
Q: Do "Enzymatic Browning reaction is intensified with the presence of oxygen?.
A: Introduction Enzymatic browning is a chemical process that we can see in fruits, vegetables etc. .…
Q: 10 b. How many different proteins composed of 100 amino acids could possibly exist?
A: The building blocks for the synthesis of proteins are amino acids. 20 different amino acids…
Q: 5. A young woman decided to lose weight and abstained from fat-containing food for several months.…
A: During weight gain there are changes observed in the size of adipocytes in which the surplus of…
Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…
A: Fats are glycerides (mono, di and tri), sterols, phospholipids and free fatty acids. it is stored in…
Q: Which of the following is required for RNA splicing to occur? a 2´ hydroxyl group a free 5´…
A: Introduction: Eukaryotic genes often contain intervening sequences called introns that separate the…
Q: Question # 1: A shampoo bottle lists "partially hydrolyzed protein" as one of its ingredients. What…
A: Almost every hair product on the market today contains protein in some way or another. Protein…
Q: Why do alcohol and water separate in DNA extraction process?
A: DNA extraction is defined as a process that is used widely for carrying out the purification fo DNA.…
Q: In the Krebs Cycle (Citric Acid Cycle), A 4-carbon compound with a 2-carbon unit to yield a 6-carbon…
A: Kreb cycle/ tricarboxylic acid cycle/ citric acid cylce - occur in matrix of mitochondria.
Q: Which of the following cell types can do glycolysis, anaerobic respiration, glycogen biosynthesis,…
A: Gluconeogenesis is a process that converts non-carbohydrate substrates into glucose.
Q: translation to the plasma membrane
A: Translation is a process in which mRNA is decoded into short peptide sequences made of amino acids.…
Step by step
Solved in 2 steps with 1 images
- What structure is labeled B? B A 台 G H FWhich of the following shows the reaction by which valine and leucine form a peptide bond H. H. H O -COO H2N-C-C-NH- C- C-OH + HO CH2 CH,SH ČH3 А. C. CH(CH)2 H. HN-C-C-NH-C- C-OH H,N-CH-C- + H,O HC-C-H CH2 CH2 H CH3 CH H,C-C-H CH(CH3)2 CH В. D.Draw the Lewis structures and determine which of these molecules has a central atom that unavoidably violates the octet rule. XeF2 OSO2 OPCI3 CS₂ OBCI 3 NO3 000 O SO3 IFS NH3 x
- Which of these statements about the tertiary structure of a polypeptide is(are) untrue? You may select more than one answer. The tertiary structure will be maintained when the solvent is changed from pure water to aqueous acetic acid. O The tertiary structure is determined in part by the formation of disulfide bridges. Hydrogen bonding interactions are responsible for formation of secondary structure but not tertiary structure, O The tertiary structure is rigid and unchanging. O Charge-charge (electrostatic) interactions can be important in the tertiary structure.Biktarvy, shown below, is a new drug that is being investigated for the treatment of HIV. HO OH F N Josep N H F F Which of the listed functional groups does biktarvy contain? Circle all that apply Alcohol Aldehyde Alkene Amide Aromatic ring Carboxylic acid Ester Ether Amine KetoneIn an ammonia molecule, one nitrogen atom (atomic number = 7; 1s² 2s²2p³) forms covalent bonds with three hydrogen atoms. Draw a diagram of an ammonia molecule. Show all valence electrons, lone pairs, molecular geometry, and partial charges (assume sp³ hybridization).
- The amino acid arginine ionizes according to the following scheme: NH, NH2 NH2 H NH, C=N C=N C=N C=N-H pk = 2.17 -H pK. = 8.99 -H pK = 125 -H* H. NH NH NH NH H (CH,)a H (CH), +H* (CH)a (CH,)a H,N-C-coo- +H* +H* H-N*-C-COOH H-N-C-Co- H,N-C-co- H. нн H. H II II IV (a) Calculate the isoelectric point of arginine. You can neglect contributions from form I. Why? (b) Calculate the average charge on arginine when pH = 9.20. (Hìnt: Find the average charge for each ionizable group and sum these together.) (c) Is the value of average charge you calculated in part b reasonable, given the pl you calculated in part a? Explain your answer.A bond linking two atoms of the same element through an equal sharing of electrons would be best defined as a Polar Covalent Bond O Nonpolar lonic Bond O Hydrogen Bond O Nonpolar Covalent BondAn organic compound with no attached functional groups is best described as a hydrophobic molecule. Select one: O True O False
- Which is responsible for the stabilization of parallel polypeptide chains in a beta-pleated sheet conformation? Van der Waals O covalent bonding O R-group interactions H-bondingWhich one of the following statements is TRUE regarding the molecule shown below? NH2 'N. II НО-Р-О- ОНОН O It is a pyrimidine-containing nucleotide found in DNA O It is a purine-containing nucleotide found in RNA O It is a pyrimidine-containing nucleotide found in RNA O It is a purine-containing nucleotide found in DNAA Uracil B Adenine HN Cytosine Guanine 2 H₂N-C 6 3 N Which of the following nitrogenous bases is represented by this structure? 5 C C N 7 IZⓇ 8 CH