Which child is adopted? Which child is the mother’s previous marriage? Who are the own children of Mr and Mrs Chan?

Q: Artificial insemination

A: Reproduction is the process of production of own kids by living beings.

Q: Create the complementary DNA strand: AGC-CGA-CCA-TTA Your answer

A: Complementary DNA It is DNA synthesized from a single stranded RNA template in a reaction catalyzed…

Q: ohubrıd with crosses

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 1. In your own words define the process of DNA Replication, Transcription, and Translation.

A: DNA Replication  In the process of DNA replication, the DNA makes multiple copies of itself. It is a…

Q: Can you help me the name of the labels?

A: Axon is a part of the neuron, which is a structural and functional unit of the nervous system. Axon…

Q: Can you show me the testcross

A: Recombination  Recombination is the process where a part of chromosome is broke up and bind with…

Q: Collection of microscopic DNA spots attached to solid surface area) Orthologb) Syntenyc) Paralogd)…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: DNA Fingerprints Cat Kittens IL || ILL || I I

A: DNA fingerprinting is a technique used to compare sequences in genomes using satellite DNAs like…

Q: CHILD #1 Genotype Phenotype | | | ||| From Edward From Jenna

A: Given: D = long eyelashes  d = short eyelashes B = Brown eyes        b = red eyes F = freckles…

Q: You are working as a CSI analyst. You collected DNA at a crime scene that is from the suspect but do…

A: If the collected DNA at the crime scene is from the suspect but the amount is not enough to run a…

Q: Can you help me the name of the label of this picture?

A: Brain is a complex structure which control and coordinates different body function by the cells…

Q: "There has been a terrible mix up in the newborn wing of the hospital when an intruder was caught…

A: DNA fingerprinting is a technology used for DNA comparison. In this, using a specific gel the DNA…

Q: Examine the gel from a Rape investigation below. If you were the DNA analyst you would conclude…

A: DNA, or deoxyribonucleic acid, is the building block for the human body which is a powerful…

Q: Answer in point. Should be correct. Else

A: INTRODUCTION Screening techniques It included Blue white assay, Agarose gel electrophoresis, replica…

Q: enotype AaDdEe is

A: The accompanying Punnett Square shows the genotype of F1​  age:  AbD abD​  abd AabbDd aabbDd​ ​…

Q: Create the complementary DNA strand: ACC-GCC-TAG-GCA Your answer

A: Complementary DNA (cDNA) is a copy of DNA from the mRNA molecule produced through a reverse…

Q: Why was half of each plate covered with an index card?

A: UV stands for ultraviolet rays. They are electromagnetic radiation. Ultraviolet radiation mainly…

Q: Parental Cross= SsBb x SsBb

A: When one pair of contrasting characters cross each other,this is called mono hybrid cross. Such as…

Q: 15 11

A: Spinal cord is a long, tubular structure of the nervous system. It arises from brainstem and extends…

Q: Separate the word into their word parts and then define each word part. Carcinogenic

A: Cencer is disease form where the cells of the body keeps dividing eithout stopping as it losses…

Q: phenotypic ratio

A: During reproduction alleles from both the parents are passed on to the gene of offspring. However…

Q: Choice answer asap

A: The glomerular filtrate is the fluid that flows through the Bowman’s capsule’s lumen after being…

Q: ntroduction to a report on the extraction of DNA using the technique of salting out method.

A: DNA molecule is the larger molecule that consists of a chain of nucleotides which was organized in…

Q: The left side has to be matched to the right side.

A: Amoebozoa is a protist group of around 2,400 species of amoeba. Opisthokonta is a eukaryotic group…

Q: Body Covering: DNA: GGGAGTGTATACGGGATGAAGGCGATT MRNA: 12 protein: phenotype:

A: To make proteins transcription happen, which mean DNA(genes)>copy of gene>protein, this is the…

Q: 25.84 (Chemical Connections 25C) Why is it easier to exclude someone via DNA fingerprinting than it…

A: There are several techniques of biotechnology that are used in the forensic sciences. These…

Q: Crime Scene Investigation: Cindy was attacked by a masked assailant but she managed to scratch him…

A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…

Q: ich of the following has the same genotype but different phenotype wo brothers lentical Twins…

A: Genetic constitution of an individual is referred to as genotype where as how the individual appears…

Q: Describe the functions of various enzymes involved in DNA replication.

A: A complex process that occurs during the cell cycle's S phase, where copies of DNA are synthesized…

Q: Mr. Chan's family consists of mom, dad and four kids. The parents have one daughter and one son…

A: The DNA fingerprinting technology helps us in identifying the paternity and maternity test based on…

Q: DNA Gene Trait DNA Replication Nitrogen Base Chromosome

A: DNA DNA or Deoxyribonucleic acid is a molecule that contains the instructions, required for the…

Q: Any change in WT DNA sequence without any phenotypic appearence Mutant Mutation Genotype Phenotype

A: Any change occurs in wild type DNA sequence is called mutation.

Q: Twins may or may not be identical. Comment.

A: Fertilization is the fusion of gametes to initiate the development of new individual organism or…

Q: Genotype Phenotype | | || From Edward From Jenna

A: Inheritance is passing of character from parent generation to progeny. Genetic makeup of an…

Q: Does this picture show a positive or negative Sudan IV test?

A: The sudan IV test is use to detect lipids. The procedure involve the addition of few drops of Sudan…

Q: In this gel, if lane two is DNA from the crime scene, which lane contains DNA from a suspect…

A: DNA profiling is a technique extensively used for forensic investigations like for comparing DNA…

Q: detacched earlobe phenotype and genotypes

A: A genotype is the genetic makeup of an organism. Phenotype is the observable morphological…

Q: Is the answer child two because it only matches the mothers DNA, or is there a better explanation?

A: The autoradiography is a technique that uses X-ray film to see or recognize the fragments or…

Q: If our DNA contains all the information about who we are, how can something that does not involve…

A: Introduction: The term "phenotype" refers to the observable physical properties of an organism. An…

Q: SUS 1 SUS 2 EVID 1 2 3 4 7 8 9 ||

A: DNA is the genetic material present in the nucleus of the eukaryotic cells.

Q: 10

A: Answer:- The picture attached to the question is of a muscle. It's a deltoid muscle.

Q: Characteristics (Manifestations) of-9 life through which we cannot understand the life of living…

A: Any biological, living system that acts as a separate entity is referred to as an organism. Cells…

Q: Which suspect is the perpetrator of this crime? Explain the results you see in the DNA gel. Why each…

A: From the PCR analysis it is found that the two TH0 allele of both the DNA from CS and DNA from…

Q: he probability of rolling a two or four on a six sided dice

A: Probability can be calculated as follows- p(E) = number of favourable outcomes/ total number of…

Q: DNA fingerprinting.

A: A genetically modified virus is a virus that has been altered or generated using biotechnology…

Q: 5.

A: It is a median section of the brain.

Q: Rosalind Franklin was unable to calculate the dimensions of the DNA molecule.   True   False

A: Rosalind Franklin was born in London, England. She was offered at King's College in London for three…

Q: Modified true or false. Write the correct answer if the underlined word is false.

A: Any organic molecule that consists of a basic amino group, an acidic carboxyl group, and a distinct…

Q: )Following figure is showing the DNA fingerprint analysis on the one locus of a man with four…

A: DNA Fingerprinting is used to find the parents of the child It is used for paternity testing and…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.