what is the the function of the protein related to KGD1

GGGAGTGTATACGGGATGAAGGCATT MRNA: Protein And the phenotype?

What is the major biological function of the Son-of-Sevenless (SOS) protein?

would a nonsense mutation at the beginning of the gene, or at the end of the gene, have a greater effect on the shape of the protein produced?

What are the four types of protein modification and their descriptions

What are aminoacyl-tRNA synthetases?

Can goosecoid protein be found in all organisms?

If you have the same protein loaded in two different lanes of an SDS-PAGE stained with Coomasie blue, and one lane has a darker, thicker band of protein than the other lane, can you say that there is more protein in the lane with the darker band? Why or why not?

Which amino acid is coded by the mRNA codes UUG

What is the role of a protease? Why is chymotrypsin considered to be a serine protease?