Answered: what is the genotype of a pure breeding…

Science

Biology

what is the genotype of a pure breeding myopic person

Essentials Of Human Development

1st Edition

ISBN:9781285647357

Author:Kail

Publisher:Kail

Chapter2: Biological Foundations: Heredity, Prenatal Development, And Birth

Section2.2: From Conception To Birth

Problem 5TY

See similar textbooks

Related questions

Q: Cleft lip and cleft palate can be a devastating congenital disorder. Please explain why this…

A: A congenital disorder is an inherited medical disorder that occurs in a baby at or before birth.…

Q: Moving to another question will save this response. Question 10 This plant community covers about…

A: Introduction :- A wetland is a unique environment that experiences seasonal or constant flooding…

Q: Determine an easier method to detect the gene encoding for a specific toxin.

A: Introduction Toxins are poisonous substances that are produced by living cells as a part of their…

Q: Directions: Use your basic knowledge of recombinant DNA technology to answer the question. Scenario:…

A: PCR(polymerase chain reaction) is a molecular method to make multiple copies(amplify) of a small…

Q: when you eat food that contains carbohydrates you break down the carbohydrates into a…

A: Carbohydrates is a biomolecule which is consisting of hydrogen, oxygen and carbon. It is one of the…

Q: The per capita growth rate of the flowering rush population above from 2009 to 2016 was Answer: Show…

A: Introduction The population growth rate is defined as the change in population that occurred per…

Q: The time it takes for blood to pass through the capillaries of a pulmonary alveolus typically is…

A: Introduction: The facilitation of gas exchange between the circulatory system and the outside…

Q: Did the investigator collect adequate information to determine the source of the outbreak? Provide a…

A: Introduction Disease outbreak investigation involves steps to identify the cause of a disease…

Q: Explain why the tree swallow and the brown bat do not occupy exactly the same ecological niche. why

A: Introduction Ecological niche, in ecology, refers to the Relationships of an organism with the…

Q: any different functions reproduction can ser

A: The answer is given below,

Q: Determine the reasons due to which the result indicates that horizontal gene transfer has taken…

A: A technique for transmitting genetic material between nearby microorganisms is called horizontal…

Q: What is the longest bone in human?

A: There are 206 bones present in an adult human. These bones vary in shape and size depending upon…

Q: Determine whether the gene transfer takes place through transformation or transduction.

A: Introduction: Bacterial genetic material is transferred in three different ways. Lederberg and…

Q: What is uterus

A: Introduction Life starts from a single cell called Zygote. A zygote is formed by the fusion of the…

Q: You've been out in the field collecting data on the predation of holly leaves. You collect 200…

A: Leaf miners are the larva stage of insects that resides on leaves for shelter and food. Leaf mining…

Q: Determine the correspondence of the gene X and gene Y to the mutant gene causing Trp-phenotype

A: An organism's genotype is influenced by its genome as well as by its environment. The physical…

Q: Structure and functions of root hair cells?

A: The root hair cell is an epidermal offshoot that forms hairs of the root of the plant. Essentially,…

Q: What orchestrates cell differentiation? Why is cell differentiation important? What does it lead to?…

A: Introduction :- Unspecialized cells become specialised through the process of differentiation to…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: Is omicron deadly

A: Introduction The novel coronavirus SARS-CoV-2, which first appeared in Wuhan, China in 2019, and…

Q: Describe the effect of the deletion on co-transformation of pure and pepN genes that are isolated…

A: Transformation is a process of transforming the genes of one strain and then transferring it to…

Q: Q4. Select the missing evaluation given the plant characteristic. Plant Characteristic Underground…

A: Due to their geophilic nature, the stems lack shade of green and are altered to conduct a variety of…

Q: Bison roamed free in an area along the eastern slopes of the Rockies, in what is now Banff National…

A: Gene frequency:- it is usually represent the percentage of the population that have one type of a…

Q: Q6. Determine if the level of organization is molecular or cellular. Copy and paste, molecular or…

A: Introduction The hierarchy of complicated biological processes and structures that, in a…

Q: WHAT ARE THE SOIL FERTILITY ISSUES WHICH ARE LIMITING FACTORS OF SUCCESSFUL CROP PRODUCTION

A: Introduction Due to increased use of fertilizer, pesticides and excessive irrigation. There is…

Q: Metabolism is defined as: the sum of all anabolic and catabolic reactions in an organism. O a…

A: Metabolism is the process by which your body converts what you eat and drink into energy.

Q: 8. The table below shows what happens when we inhale. Gas Inhaled 20.71% 0.04% 1.25% Exhaled 14.6%…

A: Introduction The process of respiration (inhalation of oxygen and exhalation of carbon dioxide) is…

Q: What does actually determines the no of nuclear pores present in a nucleus?

A: The nuclear pore is indeed a protein-lined channel in the nuclear envelope which controls molecule…

Q: Explain how the following factors affect the blood velocity and volume flow rate as well as…

A: Blood flow Blood flow describes how blood travels through the veins, through capillaries, and…

Q: What happens when an ecosystem is in equilibrium?

A: In an ecosystem different organisms live together and interact with the environment. Ecosystem is…

Q: What is the melting temperature and G/C content of the following primers? a.) 5’…

A: A primer is a short single strand of DNA that serves as a starting point for DNA synthesis of a new…

Q: on a gene in a microorganism that provides a characteristic you find interesting. However, I want it…

A: Microbes are one of the smartest living entities in this living world. As a part of evolution, they…

Q: What are the functions of chlorophyll and the photosystems?

A: Introduction: Chlorophyll pigment is responsible for the green coloring of plants. Chlorophyll is…

Q: Starting with one double-stranded DNA, what is the total number of double-stranded DNA after 5…

A: PCR (polymerase chain reaction):- it is a mechanism to amplify the segment of DNA into millions or…

Q: Please explain what natural selection is and how it affects the gene pool.

A: Change in the heritable characteristics of biological populations over successive generations is…

Q: A cross between an orange-brown male and a homozygous black female produce four kittens. What is the…

A: Given information The cross is between an orange-brown male and a homozygous black female. Black…

Q: What evidence supports the hypothesis that mitochondria preceded plastids in the evolution of…

A: Introduction Evolution is the key process that regulates the survivability and continuity of species…

Q: Choose the CORRECT order of reactions that are conducted by photosystem I. P700 is activated by two…

A: Introduction Plants and other living things employ a process called photosynthesis to transform…

Q: what is mitosis

A: Cell division is a metabolic phenomenon takes place inside the cell in which parent cell undergo…

Q: Write an expression to describe the amount of energy, x, a tertiary consumer receives from a…

A: Introduction :- Those who consume secondary consumers are referred to as tertiary consumers (large…

Q: What are SER? What are the functions of SER?

A: Introduction: The endoplasmic reticulum (ER) is commonly defined as a three-dimensional structure of…

Q: Determine the reason behind the penicillin enrichment.

A: The genes are a series of nucleotides found on chromosomes that code for a particular protein that…

Q: Which reaction is irreversible? oxidized glutathione + NADPH + H+ → reduced glutathione + NADP+…

A: Introduction: When a reaction is irreversible, it cannot be reversed, i.e. the products do not…

Q: An allosteric regulator of glycogen synthase is: UDP-glucose. cAMP. glucose 1-phosphate. ATP.…

A: Introduction: The enzymes glycogen synthase and glycogen phosphorylase control the allosteric…

Q: 1. Why are the finds at Malapa remarkable compared to other fossil sites in Africa? dib

A: The branch of biology known as evolutionary biology examines how natural selection, common ancestor,…

Q: 15. Antibiotics provide the best defense against viruses a. b. True a. b. False 16. Cocci bacteria…

A: Introduction Small, single-celled organisms are known as bacteria. Nearly all areas of the planet…

Q: If two unaffected parents have an affected child, they must be what of the gene

A: Given condition: Two unaffected parents have an affected child. This is possible only when both…

Q: Hardy–Weinberg equilibrium

A: Gene: Gene is defined as an inherited factor which determines the characteristic feature. Allele:…

Q: Summarize the mRNA translation steps of protein synthesis, which are: initiation, elongation, and…

A: Translation is the process of synthesis of proteins from mRNA.

Q: Reproduction of giant cell?

A: Introduction: Multinucleated, inflammatory, and massive cells make up giant cells. These essentially…

Question

what is the genotype of a pure breeding myopic person

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In neurofibromatosis the phenotype does not always correspond to the genotype, what is this effect called and why may we observe this?
Define autoantibody
what are the types of down syndrome
Which of the Pedigree Diagrams below is most likely to show a family with Becker muscular dystrophy?
Imagine for a minute your patient did have findings of a back strain; what physical findings might you find on a patient with a back strain?
Do you think a patient needs to have the SAME two mutant alleles of CFTR to present with/have cystic fibrosis? Why or why not?
Jacob and Patau Syndromes List the similarities and differences between these two syndromes. Which of the syndromes is more severe?
What is the most likely mode of inheritance for myopia? Select one: OA X-linked recessive OB. X-linked dominant OC. Autosomal recessive O D. Autosomal dominant Pedigree Demonstrating the Inheritance of Myopia
Explain the concept of mendal's law of inheritence?
What are newest advances in early diagnosis and confirmation of Huntington disease? Explain the difference in inheritance pattern and the frequency to have affected progeny in the case of these three inherited diseases: Huntington, Cystic fibrosis and Duchenne muscular dystrophy. What therapies can be used or recommended for patients experiencing any of these inherited diseases?
A certain couple has six children – four boys (ages 2yr, 5yrs, 9yrs and 11yrs old) and two girls (ages 5yrs and 7yrs old). The oldest boy shows the symptoms of Duchenne Muscular Dystrophy (DMD). What are the chances of their other children developing the disease?
How can epistasis explain incomplete penetrance?