What is the difference between G-actin and F-actin?Different polarity statesO Branched and non-branched formsDifferent gene productsPolymerised and non-polymerised formsO Active and non-active forms

Answered: Image /qna-images/answer/45448a3c-cc0d-44e0-a127-fc0204c06454.jpg

Answered: What is the difference between G-actin…

Science

Biology

What is the difference between G-actin and F-actin?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Related questions

Q: ON THE WATER-CONDUCTING STATION, COAGULANT IS USED FOR water disinfection 2. desalination 3.…

A: Water treatment is the process of enhancing the quality of water so that it can be used for a…

Q: 28. Analyze the graph of the growth curve representing the human population of Ireland before 1900…

A: Introduction The rise in the number of people in a population or dispersed group is known as…

Q: Which white blood cells participate in innate defenses?

A: INTRODUCTION Innate immunity :This is the first defence mechanism against the invading pathogen.

Q: kept at 37 degrees protect from light chill in crushed ice Celsius cold agglutinin acetone carotene…

A: cold agglutinin- keep at 37 degree celsius .…

Q: Introgression from Neandertal and Denisovan relatives in our past has resulted in many humans around…

A: Introduction Evolution is the process of a species' characteristic changing over several generations…

Q: shake it. closed checked to ensure that it does not exceed the maximum permissible concentrations of…

A: Science is humanity's greatest blessing. It has altered human existence; nothing finer could have…

Q: The secondary cleavage plane is meridional but is found at right angles to the first cleavage plane.…

A: Embryonic Cleavage Fertilization is an event in which male and female gametes fuse to form a single…

Q: Identify and label the following parts using the image attached below Esophagus Salivary Gland Crop…

A: Identification and labelling :-

Q: 1. In your own words define the process of DNA Replication, Transcription, and Translation.

A: DNA Replication In the process of DNA replication, the DNA makes multiple copies of itself. It is a…

Q: Flashes means Floaters .A true .B false

A: Introduction Ophthalmology is a medical specialty that focuses on the diagnosis and treatment of eye…

Q: 9. After binding to an antigen, T cells activate and differentiate into one of three cell types.…

A: Answer : T cell divided into three types of T cells when bonded with an antigen these are :…

Q: 1.10 All of the following statements about plants are true except one. Select the statement that is…

A: Answer : The correct statement would be : A protected embryo is a characteristic of angiosperms…

Q: Part 3: Sex Linked Traits 1. Cross a white eyed male with a wild-type female. What are the…

A: Introduction Drosophila melanogaster is a fly species belonging to the Drosophilidae family. The…

Q: There is Hyaluronic acid synthesis occuring in Group X Strep and it is controlled by an operon with…

A: has operon Hyaluronic acid synthesis operon is an operon system that is required for synthesizing…

Q: USING A TABLE, DISCUSS THE DIFFERENT METHODS FOR THE DETERMINATION OF TOTAL PROTEIN.

A: Biuret Method A violet-purplish color is produced when cupric ions (Cu2+) interact with peptide…

Q: Briefly discuss at least two possible explanations for why bipedalism may have initially developed,…

A: The original proponents of this model theorized that bipedalism originated as a natural defense…

Q: 11. What happens when B cells proliferate in response to signaling from a helper T cell?

A: We know that B cells synthesize and secrete antibodies whereas T-cells do not make antibodies .…

Q: Why should culture media after inoculation be incubated at an optimal temperature immediately?

A: Culture media, also called as growth media, are particular combinations of nutrients and other…

Q: Can you identify 3 more chemical tests?

A: Peptide bonds of proteins are hydrolyzed by either strong acid and strong base. Amino acid sequence…

Q: Define symbiosis.

A: Individuals live together in an ecosystem and depend on one another. These interactions are called…

Q: What is the phylogenetic relationship between Homo heidelbergensis, H. sapiens, and H.…

A: Homo heidelbergensis began to develop regional differences that eventually gave rise to two species…

Q: What is polyspermy? What are the processes involved to prevent polyspermy occurring?

A: Fertilization can be defined as the union of two haploid gametes, the spermatozoa and the oocyte,…

Q: 3. Matching type sodium sodium clot activator EDTA heparin fluoride citrate light blue red light…

A: Introduction Blood is a bodily fluid found in the circulatory system of humans and other animals…

Q: 4. Autotrophs harvest energy directly from the environment and store it in the form of sugars and…

A: Introduction In the presence of sunlight, photosynthesis is the process of forming organic matter…

Q: How do opioids interact to its receptors? Explain the structural requirements to act as agonist.

A: Opioids- These are a group of analgesics that are commonly used in clinical conditions by medical…

Q: It is the body fluid cavity in insects

A: Since you have asked multiple questions, we will answer only first question for you. In order to get…

Q: What is the role of medical technologist in relation to the Continuing Professional Development?

A: Continuing professional development in short known as CPD. It is basically the healthcare…

Q: Q6. Guinea pigs, which were homozygous for long, black hair were crossed with ones which were…

A: Given, guinea pigs which were homozygous for long, black hair were crossed with the ones which were…

Q: When is Cellophane Tape or Scotch Tape Preparation done? This method detects which pathogenic agent?

A: The large intestine and rectum are home to adult Enterobius vermicularis worms. They do not lay eggs…

Q: 28. Analyze the graph of the growth curve representing the human population of Ireland before 1900…

A: Hello dear, According to the guidelines I am only permitted to answer your one question. Your both…

Q: 71. The scolex of T.saginata has: I. 4 suckers II. 2 suckers ad 14 hooklets III. 26-28 sucking discs…

A: The scolex of T.saginata has:

Q: 1. List and describe 4 examples of barrier defenses.

A: Introduction Natural barriers and the immune system protect the body against infection-causing…

Q: Q2: These plants have both staminate and carpellate parts. • Complete plants Perfect plants…

A: Plants are classified into several types based on the basis of their growth habit. Explore more…

Q: Part 5: Linkage Groups When two alleles are located on the same chromosome they are inherited…

A: Given: Vestigial wings (VG) and Black body color (BL) are located on chromosome 2. 7. Cross between…

Q: 1.10 All of the following statements about plants are true except one. Select the statement that is…

A: Answer : The correct answer would be according to the question would be : Option B) a protected…

Q: vein color that is intermediate to the parental phenotypes. This likely means this trait is governed…

A: Inheritance depicts the pathway of the genetic traits and its expression from one to another…

Q: Bluebirds are songbirds that, like wood cavities in trees. European house sparrows, which have been…

A: A population has restricted assets and resources for a particular number of animal varieties. This…

Q: The right side of the heart pumps the blood _____ the heart _____ the lungs A. to, from B. to, to C.…

Q: Which statements explain the primary difference between the structure of a nucleic acid and the…

A: INTRODUCTION DNA : Genetic material made-up of nucleotide. Protein : Macromolecule madeup of amino…

Q: Sperm whales have a specialized spermaceti organ in their head cavities filled with wax cetyl…

A: Every species is different from another due to some special characters. This is the reason behind…

Q: Magnifiers cause sticky eye .A true .B false

A: You might well have woken up having wet or crusty material in your eyes if you have allergy or a…

Q: Which one of the following is related to ozone formation? A) Photosynthesis process B) Photochemical…

A: Ozone is made once heat and sunlight cause chemical reactions between Volatile Organic Compounds…

Q: Q1: These channels that cross cell walls of plants helps them to communicate Vacuole Plasmodesmata…

A: Plant cell A plant cell is the basic living unit of all plants. These cells combine to form tissues…

Q: write in one or two sentence for each please. Define the following terms: a. biotechnology:…

A: Introduction Biology:- It is a branch of science that deals with living organisms and their vital…

Q: The United Nations predicts that the human global population is most likely to stabilize at 9…

A: Genetic drift It is also known as allelic drift. It refers to the frequency alteration of existing…

Q: coccidians

A: Cutaneous larva migrans (CLM) is a skin disease in humans, caused by the larvae of various nematode…

Q: For pGLO plasmid that contains araC gene and Ampr gene, what are the names of their promoters and…

A: pGLO plasmid pGLO plasmid is a 5371bp genetically engineered plasmid to create genetically modified…

Q: Drug resistance occurs O against antibiotics and not against synthetic chemotherapeutic agents. O…

A: As per our honor code, we are allowed to answer only one question at a moment. You have posted…

Q: How did the data from biogeography, comparative morphology, comparative embryology, helped in making…

A: Unified Evolution Theory. Environmental epigenetic changes elevate hereditary transformations to…

Q: Which classification group do we share it with all primates? A. Genus B. Class C. Order D. Family

A: Classification is a process by which we devide the organism into different convenient catgories…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

What is the difference between G-actin and F-actin?
Different polarity states
O Branched and non-branched forms
Different gene products
Polymerised and non-polymerised forms
O Active and non-active forms

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Why do you think this substituion is named " NonSense". In your response explain what it means to have a stop codon. Use evidence from the diagram. Ready? Enter your answer here.
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
Given DNA strand: 5' T G T T A G T C G A A T 3' Write its complementary DNA and its mRNA.
. Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some ofthese mutant proteins are of normal size (but haveamino acid substitutions) while others are short, dueto deletions or nonsense mutations. The first extralong example was named Hb Constant Spring, inwhich the β-globin has all of its normal amino acidsplus several extra amino acids attached after thenormal C-terminal end of the protein. a. What is the most plausible explanation forits origin?b. Is it possible that Hb Constant Spring arose fromfailure to splice out an intron?c. Estimate how many extra amino acids mightbe added to the C terminal end of the mutantprotein
5 T G T T A G T C G A A T 3 what is the complimentary dna and complimentary mRNA
3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence transcribed from template?Amino acid sequence of peptide?and Type of mutation?
Imagine you need to move a large protein from one region in the cell to another. Which of the following proteins would be able to do this? Onuclease O myoglobin O kinesin Oligase O hemoglobin O myosin
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?