What is the complement of 5’ -AGGTCGTAC-3’ ? 5’ – GCTAGTCAG-3’ 3’- AGGTCGAGT-5’ 3’- GAACTACGT-5’ 5’-TCCAGCATG-3’ 3’- TCCAGCATG-5’

Q: 14. Write the karyotype of a Turner syndrome. O A) 2n = 46 - 1 O B) 2n - 1 = 45 O C) 45, X O D) 46 -…

A: Karyotype is defined as the combination of the chromosomes of an individual. It is a laboratory…

Q: QUESTION 7 Which sequence is the complement to sequence 5'-AGTTACTAAA-3'? O a. 5'-TCAATGATTT-3'…

A: Ans is... c

Q: Cal- 2 Aal-rl 4254 4209 Wind 29 E 1 - Nhel 29 Sgr Seal 3 Rl 4s Pul 3733 Sall- At-n 5 Al 3 Eag s ll…

A: IDENTIFICATION OF RECOMBINANTS  Plating on to a selective medium enables the transformants to  Be…

Q: In 1-3 sentences define Sense, Missense, Nonsense mutations, Frameshift mutations, Allelic…

A: The cell is the basic structural and functional unit of life. It carries out various functions in…

Q: what diagnosis would you give patient A?  I want to make sure if I'm right and if I'm wrong where…

A: Each cell in the human body contains 23 pairs or 46 chromosomes. Half of these chromosomes come from…

Q: What kind of daughter cells will result if the "Normal cell" above goes through mitosis?

A: Mitosis  It a kind of division in a cell cycle where two identical daughter cell is produced.

Q: Humans have about 21,000 genes, yet can make millions of different antibodies. In 3-4 sentences…

A: VDJ recombination is Also known as somatic recombination, this is a mechanism of genetic…

Q: a. In how many cells has meiosis occurred to yield these data? b. Give the best genetic map to…

A: A genus of Ascomycete fungi is called Neurospora. Neurospora species are molds with widely dispersed…

Q: Why does Valerie's blood from her peripheral, tumor and breast samples all show bands of DNA that…

A: Many risk factors for cancer have been identified, including exposure to certain carcinogens in our…

Q: 7. (Autotrophs, Heterotrophs) are organisms that can produce their own food.

A: Autotrophs are referred to as producers because they can produce their own food from raw materials…

Q: Daichi Yamada, 65 years old, immigrated to California to live with his son after the Fukushima…

A: CML ( chronic myelogenous leukemia) is a blood cancer caused by mutation. The reasons behind…

Q: Jekyll-Hyde Afflicted Spider Curse Afflicted Jekyll-Hyde/Spider Curse Human 2. II 2 III 3.…

A: Pedigree charts are very useful for determining if the disease in question is autosomal dominant or…

Q: Help me answer this —> One day you were running around the neighborhood park with a bag full of…

A: there are three varieties of grasshoppers: 1. green coloured 2. brown coloured 3. green and brown…

Q: Albright syndrome is caused by a mutation in a gene that is imprinted. A is the wild-type allele and…

A: AbstractThe disease results from somatic mutations of the GNAS gene, specifically mutations in the…

Q: A 1:1 phenotypic ratio will occur when which of the following crosses is done? Select one: O a. Ttx…

A: Allele: genes that occupy a position on homologous chromosomes and control the same characters but…

Q: Below you will find the normal p53 gene found on chromosome 17 and a mutated version of the gene.…

A: To solve such questions, we should know the corresponding complementarity between the bases and that…

Q: 1. Codominance n the human "ABO" blood group system, blood type is determined by three alleles…

A: If a single copy of a genetic characteristic is expressed in a person, it is termed dominant. While…

Q: Which process is illustrated in the diagram? Replication Q Search # D C 1 HII 8 88357 #0 a 0 40 m…

A: Deoxyribonucleic acid, or DNA, is a molecule that contains the genetic data and instructions…

Q: Barr bodies are diagnostic feature of X inactivation A- true B- false

A: Therians are a subclass of mammals that give birth to their young ones. They do not lay eggs. They…

Q: A 1:2:1 genotypic ratio will occur when which of the following crosses is done?

A: The genetic complete genetic make up of an organisms is known as genotype.

Q: 3 & 4. Identify the labelled structures: X- and Z-

A: Brain is main controller of the body . According to region, It is divided into :-  A ) Forebrain.  B…

Q: EboV Strain 1 EboV Strain 1 (Circle the mutated bases)  CCA TGT AAG TGG TTA mRNA…

A: In order to synthesise messenger RNA with the help of DNA template strand  RNA polymerases adds…

Q: ntify each stage of mitosis shown below: a. LM (1600x) b. LM (1600x) C. LM (1600x) d. LM (1

A: Introduction :  Cell division is the process through which a cell matures and divides after a…

Q: A G UUU Phe UCU U UUC UUA UUG UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop A Stop UGG Trp G Tyr UC…

A: The term protein is associated with a biomolecule form that gets generated after the polymerization…

Q: Genes D, E, F, and G are located on the same chromosome. The map distance between the genes is shown…

A: When the genes are present on the same chromosome, they are termed as linked genes. The phenomenon…

Q: Person and blood Type  Probable Genotype  Possible Gametes  Mrs. Simons------A +  IAIA + -, IAi…

A: The classification of blood on the basis of presence or absence of antibodies is called a blood…

Q: Dna sense strand :        5' ATG TTT CAA CGA GGT GTT TGA 3' Dna anti-sense strand: 3' TAC AAA GTT…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: 1. The location of hemophilia C- factor XI is 4q35, where exactly is it? Describe. 2. Referring to…

A: Chromosomes carry several genes and their exact location is called as loci. It is represented by…

Q: S-Susceptible individuals E- Exposed individuals I- Infected individuals V-Vaccinated individuals…

A: The Susceptible-Exposed-Infectious-Recovered (SEIR) model is a compartmental model used to describe…

Q: number 32

A: Introduction:- A basic unit of heredity and a sequence of nucleotides in DNA that encodes the…

Q: What does DNA stand for?

A: DNA stand for Deoxyribonucleic acid

Q: The afflicted individuals in the pedigree have dysphasia-like condition. The gel below shows results…

A: A verbal disorder known as dysphasia or aphasia. It has an impact on how you speak and comprehend…

Q: SARS-CoV-2 spike engagement of ACE2 primes S2' site cleavage and fusion initiation

A: The SARS-CoV-2 virus's spike (S) glycoprotein is a class I fusion protein which covers the viral…

Q: 32 A¡A1: 36 A1 A2 : 60 A¡A3 57 A2A2 : 90 A2A3 :125 A3A3 a) Find the gene frequencies after one…

A: A gene is a unit of genetic material and alleles are the alternative form of genes present at the…

Q: Can UVC light wands kill COVID-19

A: COVID-19 is the disease caused by a new strain of coronavirus, severe acute respiratory syndrome…

Q: During the process of genetic transduction in bacteria, two living cells exchange segments of their…

A: Transduction Unlike transformation in which the naked DNA is transferred in Transduction DNA is…

Q: Label the diagram: 3'4 5' Primer 5' 15' '3'

A: The heterocatalytic processes by which a new DNA strand is synthesized on a old DNA template is…

Q: 16 please labelling it

A: We know that The human mind has a similar fundamental structure as other well evolved creature…

Q: Determine the results of an insertion of TA between positions 2 and 3.

A: 5' GTAGGGAGAACGAGACAATCTG  3' DNA 3' CATCCCTCTTGCTCTGTTAGAC  5'   5'GUAGGGAGAACGAGACAAUCUG 3' mRNA…

Q: CHALLENGE PROBLEM 3 The 10 mutants in Challenge Problem 2 were tested for complementation in all…

A: complementation means the presence of all the mutant genes and thus perform the similar function.