Answered: What is meant by the universality of the genetic code?

Name: What is meant by the universality of the genetic code?
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What is meant by the universality of the genetic code?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN: 9781305251052

Author: Michael Cummings

Publisher: Cengage Learning

See similar textbooks

Related questions

Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…

A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…

Q: Which of the following terms is used for the various forms of any one a) Autosomes b ) Codons c)…

A: Genes have a variety of different forms which are located at the same position or can be called…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: The cell is the basic structural and functional unit of the body. The nucleus is called the brain of…

Q: What are the function of exons?

A: Eukaryotic genes are mainly composed of two components - introns and exons. Introns are the…

Q: Which of the following statements regarding splicing in eukaryotes is correct?a) Several reactions…

A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…

Q: Which of the following is a reason why codons are NOT composed of only two nucleotides? Question 22…

A: The biochemical substance that is carried forward from the preceding generation to the succeeding…

Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: A standard codon table such as the one that we looked at in class gives the following information:

A: Three types of RNA interact to synthesize proteins. They are mRNA, tRNA, and rRNA.mRNA is the…

Q: What are the four major types of introns?

A: Introns are the non-coding sequence found in the genome. These are nucleotide sequences that do not…

Q: Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than…

A: Genetic code is defined as the set of nucleotides which determine the sequence of DNA of a given…

Q: The amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following…

A: Glycine is a versatile amino acid with crucial roles in protein synthesis, collagen formation,…

Q: Define both transcription and translation. In addition, describe the role(s) of each of the…

A: The two main steps involved in protein synthesis are transcription and translation. These two…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of anoth…

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

What is meant by the universality of the genetic code?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

See solution Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by stepSolved in 2 steps

See solution

Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.