Q: true or false Human ILC3 can be further divided into two subsets based on expression of the…
A: Interleukins are a broad set of chemical messengers that have a variety of roles in the immune…
Q: some of the above choices are strict aerobes and some are facultative anaerobes. This is helpful to…
A: Bacteria are single celled organism find in everywhere on earth. Bacteria are classified into gram…
Q: In the garden pea, round seeds are dominant over wrinkled seeds. An investigator crosses a plant…
A: Given :- Total count of offspring is 1000 R( Round ) and r( wrinkled) Heterozygous dominant and…
Q: 1. List 3 sustainable practices for a healthy future and healthy environment. 2. Write 3 ways these…
A: 1- Don't throw garbage on street. Always carry a bag for your garbage or throw garbage in public…
Q: 1A. If Creb upregulates gene T with acetylcholine stimulation, what happens to T when cAMP…
A: All cells receive and respond to signals from their surroundings. This is acomplished by a variety…
Q: 3d bioprinting systems, biomaterials, tissue engineering. Indicate 3 creative project topics on the…
A: 3d bioprinting : The process that utilizes the living cells along with the biomaterial to produce…
Q: List five (5) factors affecting fixation of the cells in a physical and chemical state
A: Fixation: Fixation is a procedure in which cells or tissue are fixed partially in a chemical and…
Q: What happens in the cell eventually after signals are transduced?
A: Cells communicate with each other via released proteins unique to each kind. Cell signaling can be…
Q: turtles, lizards, snakes crocodiles dinosaurs parental care keratinized skin amniote egg bipedalism…
A: Phylogenetic tree is a graphic representation of the course of evolution.It provides a way to…
Q: Which of the following specifically explains why glucose uptake into intestinal cells happens in…
A: Absorption is the process by which the end products of digestion pass through the intestinal…
Q: An individual with XY chromosomes produces gametes where 50% have an extra sex chromosome and 50%…
A: Please follow step 2 for detailed explanation.
Q: Which of the following is NOT a role for tissue-residebnt macrophages in maintaining homeostasis?…
A: Answer: Macrophages carry out crucial tissue-specific tasks and defend the organism from infection,…
Q: Where does the following reaction take place: isomerization of the 6-carbon molecule citrate Select…
A: The production of intermediate cis-aconitase converts citrate to isocitrate.This is a reversible…
Q: A single glucose molecule can drive the citric acid cycle ...... one turn 2 turns 3 turns or 4…
A: Citric acid cycle is a sequence of chemical events that take place inside all the aerobic organisms…
Q: explain and proivde anylyses what are the diagnoses and current and potential future treatments for…
A: adenocarcinoma tumors colorectal cancer (colon) can be diagnosed by following tests 1. Blood test-…
Q: List the types of adult tissues that are derived From each these > OF germ layers!
A: INTRODUCTION Three layers of germ cells Outer Ectoderm, middle mesoderm and inner endoderm.
Q: Discuss how meiosis and the events in meiosis explain Mendel’s laws.
A: Meiosis It refers to the cell division that occurs in sexually reproducing organisms that decreases…
Q: constriction of a blood vessel to one-half of its resting diameter would increase its resistance to…
A: The answer is 16.
Q: The type VI secretion system evolved from: please explain and choice the right answer porins…
A: Introduction Bacteria belongs to the kingdom Monera. Bacteria are unicellular and prokaryotic…
Q: lymph node traps antigens, make an analogy of the lymph node’s method of action and a busy highway…
A: The Immune System consists of many "cells" and chemicals that defend our bodies against infections.…
Q: Victim DNA Sperm sample Suspect 1 Suspect 2 Based on the DNA profile in the image on the right,…
A:
Q: 8. Name the six classes of enzymes and type of reaction envolve.
A: Note: As per guidelines we can solve one question at a time.ask rest questions to get answer!!…
Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…
A: There are various means of transport that are used to carry out transportation in plant and animal…
Q: Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC…
A: Restriction enzymes are the specific enzymes that recognize and cut at specific sites on nucleotide…
Q: Explain how metaphase of mitosis is different from metaphase I of meiosis.
A: There are two types of cell divisions which are involved in the distribution of genetic material…
Q: what is the answer?
A: Cell division is a process by which parental cells divide themselves to form daughter cells. It is…
Q: Acetyl Coa is a ____ carbon molecule derived from pyruvate that is used during ______. Select one:…
A: The aerobic respiration process breaks down the glucose into ATP.
Q: What is the percentage strength (v/v) if 225 g of a liquid having a specific gravity of 0.8 is added…
A: The answer is 18.75%
Q: 10) Discuss how SSRI's and MAOI's function in the brain to alleviate depression symptoms. Explain…
A: Introduction Many persons with addiction and co-occurring depression benefit greatly from medication…
Q: 3 in 3' 5' 5' 3'
A: * DNA replication is a process in which, double stranded DNA will be copied to produce two identical…
Q: The SecB protein helps export proteins by:
A: In molecular biology, molecular chaperones are proteins that help big proteins or macromolecular…
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: Glycolipids and glycoproteins on membranes are most directly involved in _____________. Select one:…
A: Glycoproteins are chemical molecules made of a protein and a carbohydrate bound together, whereas…
Q: Enzymes catalyze a chemical reaction by A. decreasing the amount of ATP required to activate a…
A: Enzyme is a protein is a substance. Friedrich Wilhelm Kuhne was the one who coined the term ' Enzyme…
Q: Samples of three different triglycerides, A, B, and C, were tested to determine the melting point of…
A: A graph of melting point of three triglycerides are given in the question and by analysing the…
Q: It is in the plants that mature cells can revert to what undifferentiated state? A. callus B.…
A: Differentiation of cells is a process in which cells changes to become mature cells to perform more…
Q: Liver 1. Explain what it means for bile to emulsify fat ? 2. Where is boiled stored ? 3. What does…
A: The digestive system helps digest food to micronutrients, which are absorbed by the body. And…
Q: Glucose represents ______________ energy that will become ____________ in respiration. Select one:…
A: 1. Glucose represents the potential energy that will become oxidized in respiration. option A.…
Q: Which is not a lifestyle change recommended with a diabetes diagnosis? Group of answer choices…
A: Introduction : Insulin is a hormone secreted by the pancreas that regulates the sugar level in the…
Q: In the following diagram, indicate the color of the xylem, phloem, cortex, epidermis and endodermis,…
A: Plants are multicellular , eukaryotic, photosynthetic structure that belongs to kingdom Plantae.…
Q: If you were to sequence a human genome today, how would the sequencing differ from that done during…
A: Genomics is the study of genomes through analysis, sequencing and mapping of genes and non-…
Q: 22. VIRAMUNE Oral Suspension contains 1% w/v of nevirapine. Calculate the milli- grams of nevirapine…
A: VIRAMUNE: Nevirapine (NVP), marketed among other names as Viramune, is a drug intended to treat and…
Q: Demonstration of Osmosis using Potato Osmoter 1. Where was the liquid cavities of some of the…
A: Introduction: The osmosis phenomena in living plant cells is demonstrated using a potato osmometer.…
Q: 16. What is the membrane potential when the ratio of the ion concentration values is X-1) / X.
A: The resting membrane potential, also known as the resting potential, is a voltage across the…
Q: 1. What are enzymes? 2. Why are they catalysts? 3. How many digestive enzymes does the body produce?…
A: Every living cells perform different activities that keeps the cell alive. Difficult different…
Q: Observe the species in your surroundings, take a picture of the leaves of at least three plant…
A: In given question three type of leaves given of Aloe Vera,organo and Banana leaves. Base is bottom…
Q: Lower birth rates and declining family size in recent years reflect what pheno
A: I think the question meant- Lower birth rates and declining family size in recent years reflect…
Q: 1.What is the official genename of the gene? Do you have another names?
A: The gene is formally represented by the suggested name. However, a particular gene has frequently…
Q: 24. In Drosophila melanogaster, ebony body (e) and rough eyes (ro) are encoded by autosomal…
A: Introduction :- A given gene is said to be autosomal if it is located on a numbered chromosome…
Q: The sodium-glucose cotransporter is an example of _____________. The Na/K pump participates in…
A: Cell membrane is being a semi- permeable in nature selectively allows the substance to move in and…
Step by step
Solved in 2 steps
- According to the American Cancer Society, colon cancer screening should begin at age 50 for people at average risk. Imagine you have a family history of colon cancer. From your research, with reasons which procedures would your physician order for you and at what age ?What are the causes of colon cancer explaining each of them in a substantial way?A patient has a stage 4 pressure ulcer on their sacral area. What type of foods would the patient MOST benefit from? Question 64 options: a) Peanuts, tomatoes, and rice b) Oats, fruits, and vegetables c) Liver, spinach, corn d) Dried beans, eggs, meats
- Why is it important to learn more about the causes of colon cancer? And why is colon cancer important?1. Differentiate between bacterial infection and bacterial intoxication. 2. Discuss the importance of E. coli as part of our intestinal flora. 3. Describe three (3) different types of gastrointestinal diseases caused by bacteria. Be sure to give the name of the specific organism that causes each, describe some common signs and symptoms and discuss treatment for each disease: 4. Define meningitis. Compare and contrast between bacterial and viral meningitis including treatment for each. 5. What is a prion? Describe the impact prions have on the human brain and discuss two prion-associated diseases in humans: 6. What is a vector-borne (vector transmitted) disease? Give an example of a vector borne disease and the vector responsible for causing it:A 68-year-old man complains of recent changes in bowel habits and blood-tinged stools. Colonoscopy reveals a 3-cm mass in the sigmoid colon. Biopsy of the mass shows infiltrating malignant glands. These neoplastic cells have most likely acquired a set of mutations that cause which of the following changes in cell behavior? (A) Decreased cellular motility (B) Enhanced stem cell differentiation (C) Increased cell-cell adhesion (D) Increased susceptibility to apoptosis (E) Loss of cell cycle restriction point control
- In the article "Epidemiology of Gastric cancer in Japan": 1. What are the new ideas/ information you learned from the research article? 2. Do you think the experiences of Japanese individuals in relation to gastric cancer are applicable to Filipinos? Why? 3. In what ways do Japanese and Filipinos differ in food preferences and eating habits? What are their similarities?ESOPHAGUS 1. The esophagus takes food from the to the 2. a) At the junction of the esophagus and the stomach is a circular smooth muscle called the b) Contraction of this sphincter prevents the backup of into theCruciferous vegetables are associated with a decreased risk of colon cancer for all of the following reasons except: they inactivate carcinogens O they are anti-inflammatory they are antiviral they inhibit apoptosis they inhibit angiogenesis