
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
What is a processive enzyme? Explain why processivity is an important feature of DNA polymerase.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.arrow_forwardCan you help find the true statement of this problem?arrow_forwardDescribe a typical program used for DNA amplification with the thermal cycler and the purpose of each steps.arrow_forward
- The function of the 3'-> 5' exonuclease activity is found in which of the following: DNA Polymerase III DNA Polymerase I DNA Polymerase II All of the abovearrow_forwardWhy do longer DNA molecules move more slowlythan shorter ones during electrophoresis?arrow_forwardFollowing base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true or False? Why? please help me explain thatarrow_forward
- The Polymerase Chain Reaction is a molecular biology tool for exponentially amplifying DNA in a test tube in a cell free system. With this technique, DNA strands are separated by heating the mixture so that a DNA helicase is not required. A heat stable polymerase (Pol Z) is then used to copy DNA over and over in a tube. Recently an improved version of Pol Z was created by fusing Protein X, a DNA binding protein, to Pol Z (see left figure below). The right panel shows that fusion of Pol Z to Protein X significantly increases its efficiency. Briefly provide a plausible mechanism for how Protein X is improving Pol Z. Which prokarotic/eukaryotic protein activity is Protein X mimicking that increases the activity of the polymerase?arrow_forwardIn the protocol for extracting DNA, what is the purpose of the clear shampoo in the DNA extraction buffer? In the protocol for extracting DNA, what is the purpose of the clear shampoo in the DNA extraction buffer? Shampoo contains detergents, that help to break down lipids in cell walls, thus freeing the DNA. Shampoo contains detergents, that help to break down proteins in cell membranes, including the nuclear membrane, thus freeing the DNA. Shampoo contains salts, that help to break down lipids and proteins in cell membranes, including the nuclear membrane, thus freeing the DNA. Shampoo contains detergents, that help to break down lipids in cell membranes, including the nuclear membrane, thus freeing the DNA.arrow_forwardIn eukaryotes, what is meant by the term DNA replication licensing? How does the process occur?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education