Q: What are the common symptoms of mitral prolapse?
A: Mitral valve prolapse is a valvular heart illness that is defined by the displacement of an…
Q: Steroid hormones are an example of lipid-soluble hormones and therefore O they do not use receptors…
A: Introduction Hormones are the chemical substances /molecules that act as "carriers" or "messengers"…
Q: A benefit of second messengers is that O they decrease the effect of negative hormones. O they…
A: The exposure to extracellular signalling molecules to the cell leads to release of intracellular…
Q: Toxell et al. (2003) examined the heritability of an adaptational response to exercise in rats. They…
A: Metabolism is the process by which energy is produced by the organism. In many organisms, some of…
Q: Which of the following is a characteristic of mammals? homodont mammary glands…
A: Introduction Mammals:- Mammals are a group of warm-blooded vertebrate animals belonging to the class…
Q: this is a glandular system that aids in the regulation of water and salt in some species of…
A: Introduction With over 28,000 species and an estimated 16,000 parasitic species, the phylum…
Q: How the nucleotide base sequence of a piece of DNA is important to know someone to solve a crime?
A: Deoxyribonucleic acid, or DNA, is a fundamental component of all human cells. Each person has a…
Q: would a mutation in E. coli make the lac operator unable to bind the active repres
A: Three genes collectively known as the lac operon are found in bacteria, and they are in charge of…
Q: James inoculated a species of bacteria into KIA media and realized that it has a yellow butt and a…
A: The correct Option of the answer for the question is Option A:-lactose fermenter The yellow slant…
Q: What are the four stages of increased intracranial pressure?
A: Using laboratory methods (analysis, microscopy, immunotherapy, microbiology, virology,…
Q: the importance of inheritance of how steps in meiosis change chromosomes through nondisjunction.
A: Introduction Crossing over is the swapping of genetic material that happens within the germline.…
Q: Why is iron important to hemoglobin synthesis, and why is iron deficiency related to anemia?
A: Hemoglobin is the protein present in the red blood cells of the blood.
Q: What is Molecular Similarities of All Life-Forms?
A: The study of living things is called biology. Their morphology, physiology, anatomy, behavior,…
Q: Pick either of these media: (EMB or HE) and describe (again, in your own words) how the chemical…
A: Note: Please note we cannot complete the table provided in question as experimental questions can…
Q: Why must m-Endo broth or some similarly selective and differential medium be used to count…
A: Coliform bacteria are described as rod-shaped, Gram-negative, nonspore-forming, motile or nonmotile…
Q: The SA node of the heart creates a pace that is faster than does not generate a pace O the same as O…
A: What is the SA node - The SA (sinoatrial) node, also known as the sinus node, represents a…
Q: All animals with a circulatory system use it for O nutrient transport gas transport
A: Introduction No one can see the many, many millions of cells that make up the body without a…
Q: Disheveled: O is a G protein O inactivates beta-catenin O inactivates the APC-containing complex O…
A: Introduction: The Wnt signalling system controls key aspects of cell fate determination, cell…
Q: structures which are hygroscopic and uncurl from the spore upon drying, aiding in spore dispersal…
A: Introduction : Spores are the single-celled reproductive unit of nonflowering plants, bacteria,…
Q: Which of the following characteristics are indicative of mammals? post-orbital bar/closure…
A: Mammals are the most advanced members of the class primate. They have mammary glands for feeding…
Q: Please describe the lifestyle of SPONGES. Components and characteristics that you should address…
A: Introduction As a sister group to the Diploblasts, sponges, which are classified in the phylum…
Q: Q50 Microbes cannot be used to produce hormones, enzymes and fuel products. A) True B) False
A: A microorganism, or microbe, is an organism of microscopic size, which may exist in its…
Q: Differentiate the screening and confirmatory test for HIV.
A: HIV:- Human Immunodeficiency virus causes AIDS i.e. acquired immunodeficiency syndrome in human. In…
Q: What are hexoses?
A: Introduction: The most basic type of carbohydrates are monosaccharides. They are categorised based…
Q: Hey, I need help with this please: Plasmid pRIT450 is 7.0 kb in length and has single PstI, EcoRI,…
A: Given: A Plasmid pRIT450 of 7.0 kb in length. It has single PstI, EcoRI, and BamHI sites. The…
Q: Explain that a virus can’t be treated with an antibiotic and why. Think about selective toxicity…
A: Explain that a virus can’t be treated with an antibiotic and why. Think about selective toxicity…
Q: What effect does AIDS have on the heart?
A: AIDS also known as Acquired Immunodeficiency Syndrome is a disease that is caused by the attack of…
Q: Why do lacunar strokes involve small infarcts?
A: A stroke is a loss of blood flow to any part of the brain.
Q: How would you classify this patient?" contaminated sample possible infection…
A: Klebsiella is a type of Gram-negative bacteria. Klebsiella bacteria are normally found in the human…
Q: What sidechain residues stabilize binding of PSTMB in the LDHA structure?…
A: The given article talks about the dynamics and binding of PTMSB to LDHA. LDHA is made up of four…
Q: Describe the various techniques and tools used by geneticists, including examples of applications in…
A: Introduction Genetics is the heredity study. This study deals with the genes passed on from one…
Q: 1. Describe the prevention of sexually transmitted gonoccocal infections.
A: Over time , the bacteria that cause Gonorrhea can spread to the bloodstream and this can lead to a…
Q: What are three psychosocial factors that affect health behavior and hhat are some of the common…
A: The term "psychosocial" describes the cognitive and social variables that cause a conditioned…
Q: At any given time in mammals, a majority of blood in the body is found in the O heart arteries O…
A: The correct Option for the answer for the question is Option D:- VEINS.
Q: What is the function of an enzyme? Name three important enzymes that are used in the digestive…
A: Introduction: Protein molecules make up enzymes, which are biological catalysts. The small…
Q: McConkey agar plate is used to determine which carbohydrates a bacteria can ferment if the…
A: To grow bacteria, required nutrients should be incorporated into the culture media. These culture…
Q: Tagging systems available in pET vectors.
A: A potent and popular method for expressing recombinant proteins in E. coli is the pET vector system.…
Q: What is the most common type of congenital heart defect?
A: The heart defects present since birth are called congenital heart defects.
Q: explain in your own words step by step the processes of human organogenesis
A: Introduction The growth and production of the human embryo is known as human embryonic development…
Q: ctions: s wrong in the following situations and provide feedback/comment on how to correct the the…
A: Vitamins are the substances that are needed in our body in very very low quantities. These are the…
Q: higher melanin concentrations are common in human populations near the equator because Group of…
A:
Q: Which one of the following are undesirable microbes in milk? Pseudomonas Lactobacilli O…
A: Introduction As the milk ages , fermentation done by lactic acid bacteria accumulates lactic acid…
Q: List the major disorders of coagulation and platelets found in children.
A: Bleeding disorders refer to a condition in which the blood clotting mechanism of the body fails to…
Q: estion 15 I In an open circulatory system O circulating fluid is distinct from interstitial fluid. O…
A: There are two types of circulatory system are present; Open circulatory system: in this blood flows…
Q: What are three types of spinal cord tumors?
A: Introduction: A growth that forms inside the spinal canal or the spine's bones is known as a spinal…
Q: What is conformation?
A: All living beings are composed of cells and cells are composed of biomolecules.
Q: the given below option what step causes a sarcomere to shorten? cross-bridge formation calcium…
A: The component of a muscle fiber that contracts is called a sarcomere. Actin and myosin make up the…
Q: What is a major function of the fontanelles?
A: Fontanel, often called fontanelle, is a soft area of the baby's cranium that is protected by a…
Q: What are the three major body parts of the phylum Mollusca? Select one or more: □a Foot Ob. Radula…
A: Introduction The majority of marine phylum, or around 23% of all described marine species, are…
Q: What is Buerger disease, and why does it occur?
A: The term "medical biology" refers to a branch of medicine that makes significant contributions to…
Step by step
Solved in 2 steps
- all the letters?asapIs it correct?Second letter U A G UUU Phe UUC, U UUA UCU) UCC UCA UAU UAC FTyr UGU] UGCCYS UUG FLeu UCG, Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CAU 1 CGU CGC Arg CUU CCU His CÁC S САА CỤC ССС Leu Pro CỦA ССА CGA CUG CCG CAG GIn CGG AAU LAsn AGU ], AUU ACU* AUC }ile A AUA АСC АСА ААС AAA Ser AGC. AGA Thr JArg AUG Met ACG AAG FLys AGG GAU ASP GACS GAA GAGJ Giu GGG) GUU GUC - Val GUA GCU] GCC GGU GGC Ala Gly GCA GGA Glu GUG GCG Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAАTTTAAATTT -3' Template strand 3'- АТАСТТТАААТТТАAA — 5' а. What are the amino acid sequences encoded peptides by the three possible reading frames? Please write your answer like this: Pro-His-Stop-Leu etc. Reading frame 1 starts with the first 5' nucleotide. ORF1: Enter your answer here ORF2: Enter your answer here ORF3: Enter…
- tus: Second letter с A UUU Phe UUC J UCU UC UAU UAC J Ser UAA Stop UGA Stop A Tyr UGU] UGC Cys UUA UUG J Leu UCA UCG UAG Stop UGG Trp CUU CỤC CỦA CUG CCU] CC CCA CG CGU CGC CAU1 CAC J CAA CAG His Leu Pro Arg CGA Gln CGGJ AUU AUC le ACU ACC ACA AAUJASN AGU S Asn Ser AGC AGA Arg Lys Thr AAA AAGJ AUA AUG Met ACG AGG GAUASP GGU] GGC GGA GGG GUU GCU GUC GUA GCC GCA GCG GACJ Ala GAA GIU Val Gly Glu GUG GAGJ The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGG1 3. Starting from the start codon, what is the third amino acid incorporated into the polynantide chaina O1. Cys Met Glu IV. Gly Third letter UCAG UCAG UCAG UCAG C. A. First letterOnly name needed.Which one is incorrect?
- он он он OH HOH2C. CH2OH он бн бн ÕH ÕHSecond Letter U A G | Phe UCU UUC UUA Tyr UGU UGC Cys /u Stop UGA Stop | A Stop UGG Trp G UUU UAU UAC UCC Ser | UCA UAA Leu UUG UCG UAG CU Leu ccc CAU CAC CAA CUU His CGU CUC CGC | Arg | C Pro CUA CCA Gln CGA A CUG CCG CAG CG AGU Ser U AUU AUC ACU ACC AAU Asn Thr AAC AAA lle AGC AUA АCА AGA | Lys A Arg G AUG Met | ACG AAG AGG GUU GUC GCU GAU GAC Asp GGU GGC GGA U Val |GCC GCA Gly C A Ala GUA GAA Glu GUG GCG GAG GGG GI've attached a picture. I just need to match the letters to the structures. Thanks!