What are the amino acid coded for each of these codons? 1.  UUA 2.  AUU 3.  UGU 4.  AAA 5. GAG 6. UAA

Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…

A: During the translation, the information present in the mRNA sequence results in the formation of…

Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…

A: Information in the gene tell the cell to make a particular protein. This information is encoded in…

Q: What are the Evidence that most amino acids are specified by more than one codon?

A: Introduction Genetic code is in the form of triplets, with the total of four nucleotides available…

Q: What is a codon and on what kind of nucleic acid is it found?

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: Consider the following 2 codons sequences. Codon sequence 1:  ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: Since among the 64 codons of mRNA 61 codify amino acids that form polypeptide chains what are the…

A: The function of the other codons is stop codon i-e to stop the translation.

Q: 1a) What amino acid would be coded for by the codon 5'AGG3'?

A: Codons are the trinucleotide sequences of DNA or RNA that specifies amino acids. There are 20 amino…

Q: what amino acid is coded for by the codon 5AAG3?

A: Proteins are constructed from amino acids. Each amino acid is made up of a carboxyl group and an…

Q: if the codon for Leucine is 5'-CUG-3'. what is the sequence of the corresponding anticodon on the…

A: A transfer RNA (tRNA) is a type of RNA molecule whose primary function is to match an mRNA codon…

Q: What is the initiator codon in both prokaryotres and eukaryotes? What amino acid is specified by…

A: The codon AUG is known as the START codon as it the principal codon in the deciphered mRNA that goes…

Q: Sequence A: 37 TCT/TCC/CTC/CTA/AAC/GTT/CAA/CCG/GTT/CTT/AAT/…

A: To identify the middle, end, and beginning sequences, we need to analyze the mRNA sequences and look…

Q: Sixty-four different codons translate into only 20 amino acids. How are tRNAS adapted to address…

A: Hello Dear Students, Q: Answer: Most amino acids are specified by more than one codon in the genetic…

Q: Provide the DNA sequencce  (not RNA sequence) for the Start Codon and 3 Stop Codons.

A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…

Q: what amino acid is coded for by the codon 5AAG3?

A: Genetic code is written in a linear form using the ribonucleotide bases that compose mRNA molecule…

Q: Why is it advantageous to have a mechanism to override the effect of stop codons in protein…

A: In the central dogma,  the Ribonucleic acid (RNA) is formed from the template of Deoxyribonucleic…

Q: How do the stop codons UAA, UAG, and UGA know to form? What if a protein stops synthesizing too…

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid. The…

Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…

A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…

Q: 1. Given the anticodon in tRNA is CUU, name the amino acid that will be added.  2. Given the…

A: Since it is a multipart question we are supposed to answer only the first three questions as per the…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: How many codons code for isoleucine (Ile)? How many codons code for tryptophan (Trp)?

A: Codons are trinucleotide sequences of DNA or RNA, that codes for a specific amino acids or stop…

Q: . By inspecting Table 4.5, discuss how the genetic code has evolved to help minimize the impact of…

A: A genetic code is a set of three nucleotide bases that is used to translate information encoded in…

Q: What is the start codon? What are the stop codons? Do any of them code for amino acids?

A: Start codon can be defined as first codon of a messenger RNA transcript which is translated from a…

Q: Which of the following statements about a transversion mutation in the sequence AGC is true?

A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…

Q: State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends…

A: An anticodon is a trinucleotide sequence that is complementary to the corresponding codon in a…

Q: What amino acid is coded by each codon? Note: Reference the Genetic code table for additional…

A: In molecular biology, the genetic code is the set of rules used by living cells to translate…

Q: What is the DNA sequence that encodes the codon AAG, with 5’ and 3’ ends labeled

A: The DNA sequence that encodes the codon AAG with 5' and 3' ends labelled must be TTC from 3' to 5'…

Q: a) The genetic code in unambigous that means many codons can code for the same amino acids. b)…

A: 1.  The genetic code is UNAMBIGUOUS:- Means that each triplet specifies only a single amino acid.…

Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…

A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…

Q: ow many of the 20 amino acids could be identified by unique condons if codons contained only two ba…

A: Because DNA consists of 4 different bases, and since there are three bases during a codon, and since…

Q: The figure below shows a ribosome in the process of translating an mRNA with a sequence:…

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: Explain what is meant by stating that the genetic code is triplet and nonoverlapping? What did the…

A: The genetic code may be defined as the exact sequence of DNA nucleotides read as three letter words…

Q: How many codons are there? How many amino acids are coded by these codons?

A: We can say that Codons are basically the three-letter code that is made up of any three of the four…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?

A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…

Q: A triplet code with three nucleotides per codon is the most efficient way to encode the 20 different…

A: Nucleotides are the building block of nucleic acid whereas amino acids are the building blocks of…

Q: What is the sequence of bases for the start codon and what amino acid is made?

A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.