UNSAVED FILE This is a recovered file that is temporarily stored on your computer. Save Mark all statements that are consistent or accurate with the topic provided. Choosing more or less than the correct options will be considered incorrect. Accurate statements related to Functions of glycocalyx: * 2. | peptidoglycan: * 1. Peptidoglycan is only present in gram- positive bacteria. Allows bacterium to stick to host cells. Forms pseudopodia for faster mobility of an organism. Peptidoglycan is found mainly in the cell walls of fungi and algae. "Hides" the bacteria from host immune Gram-negative cell wall has relatively thinner layer of peptidoglycan than gram- cells. positive. 3. Mismatched pairs: * Mitochondria : ATP production Golgi apparatus : Protein synthesis Vacuoles : Photosynthesis Type here to search ...
Q: Possible Unknown Strains: Stapylococcus epidermidis, Bacillus subtilis, Staphylococcus aureus,…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: hat cell parts are visible
A: Bacteria are single-celled microorganisms. These are not visible to the naked eyes. They are found…
Q: What are some other factors that might have contributed to rapid growth of S. aureus in the chicken…
A: Food intoxication is caused by the presence of exotoxins produced by pathogens in food.…
Q: Help indetifying the unknown bacteria ? Gram Stain: Purple Cell Morpholgy: Rods Oxygen…
A: Bacteria are prokaryotic, simple, unicellular, microscopic organisms that are devoid of membrane…
Q: Distinguish between morphology and arrangement of bacteria cells please explain well and do not…
A: BACTERIAL CELLS: Bacteria is a prokaryotic cell. They contain a single circular DNA molecule that…
Q: Hello, please answer the following Microbiology question correctly. *If you solve the question…
A: Pasteurization was created by Louis Pasteur, who also accomplished some of the earliest research…
Q: Help indetifying the unknown bacteria ? Gram Stain: Pink Cell Morpholgy: Bacillus Oxygen…
A: Bacteria are prokaryotic unicellular organism that are devoid of membrane bound organelles and…
Q: It is a couple of years in the future and you have taken a job as a WSU lab prep assistant. You are…
A: Microbes or microorganism are found all over the world in diverse types, and these are microscopic…
Q: Please write, in paragraph form, how you would identify the organism step by step. Remember to…
A: Proteus vulgaris found in people and animals' intestines are Gram-negative, rod-shaped,…
Q: Complete the following table with your observations from the prepared slides 3. Name of the bacteria…
A: Bacteria are prokaryotic organisms which are unicellular and lack membrane bound organelles. They…
Q: True/ False: you are asked to determine if the statement is TRUE or FALSE. You must write out the wo…
A: Separating macromolecules such as DNA, RNA, and proteins are done using gel electrophoresis.
Q: Write your introduction (This includes principles, significance of the study, objectives of the…
A: Answer. The Danish bacteriologist Hans Christian Gram developed the technique of gram staining in…
Q: 2. Shape and arrangement of your pathogen. Clostridium botulinum is a gram-positive bacteria that is…
A: Introduction The etiological agent of tuberculosis (TB), Mycobacterium tuberculosis, is a highly…
Q: Please answer fast Create a gram-positive, catalase-negative flow chart (in flow chart diagram) to…
A: It is critical that we understand microbes and their applications since they may be both useful and…
Q: 5. What is the definition of hydrolosis reaction?
A: The metabolism essential for life is simply a set of chemical interactions between biomolecules. A…
Q: Match the bacterium to the correct description. + Mycobacterium tuberculosis A. Gram positive…
A: Bacteria are microscopic, single-celled organisms that are thought to have been the first organisms…
Q: How does a phase-contrast microscope increase contrast?
A: Microscopy is used to visualize microscopic objects. It is important to understand the importance of…
Q: Please help using the image i attached below. There are 3 parts to this question. Describe how this…
A: Dark-field microscopy describes methods of microscopy, both in light and electron microscopy, that…
Q: Distinguish between morphology and arrangement of bacteria cells
A: Bacteria -- Bacteria are the prokaryotic microorganisms can not seen by naked eyes and are present…
Q: Classification. Match the microbe/organism to its correct classification belongs to Domain Bacteria…
A: Robert Whittaker gave the five kingdom classification in which five kingdoms are: Kingdom Animalia…
Q: Which of Microbiology test measures the use of Caspase? How does it?
A: Caspases are a kind of cysteine protease that deconstructs most cellular structures during…
Q: Molds are ubiquitous or widespread due to what visible structure? Explain in minimum of 4-5…
A: Introduction:- Molds are microscopic creatures that can be found both indoors and out. They are a…
Q: I am doing my microbiology homework and I need help with these questions: 1) List the structures…
A: Bacteria are ubiquitous, mostly free-living organisms often consisting of one biological cell. They…
Q: Solve the identity of an unknown bacterial specimen by creating a dichotomous key and using the…
A: A dichotomous key is a classification and identification system for organisms. It's a tool that…
Q: Match the expected result (purple, red, or colorless) to the following descriptions of Gram-stained…
A: The bacteria is the unicellular prokaryotic organism that maintains a definite shape since it…
Q: Why is it important for all plankton monitors to use the sample protocol for both sample collection…
A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…
Q: Can gram staining be employed as a taxonomic marker for members of Archaea?
A: *Archaea bacteria is differ in other bacteria it possess a broader range of cell envelope structure…
Q: The morphological, cultural and structural characteristics for the organism for proteus mirabilis…
A: The Gram-negative, optionally anaerobic, rod-shaped bacterium is Proteus mirabilis. It demonstrates…
Q: an Gram negative organisms.
A: M, Eosin Methylene Blue (EMB) agar is a differential microbiological medium, which slightly inhibits…
Q: Organism - Enterobacter aerogenes General characteristics of the organism. Describe basic…
A: it is a gram positive, anaerobic facultative and mesophilic bacterium. This is a proteobacteria…
Q: Purpose Solve the identity of an unknown bacterial specimen by creating a dichotomous key and using…
A: A dichotomous key is an identification tool used to differentiate organisms based on their…
Q: Dormant cells in cyanobacteria resistant to desiccation and temperature extremes.* Your answer
A: Cyanobacteria, also known as blue-green algae are members of the prokaryotic kingdom, Monera. They…
Q: Hello, please answer the following Microbiology question correctly. *If you solve the question…
A: A number of methods are used to detect or measure level of hydrogen sulfide / H2S . Some widely…
Q: Using the flowchart on Page 541 of your text, correctly identify the bacteria based of the…
A: Enterobacter are the Gram negative, oxidase negative, catalase positive and rod shaped (bacillus)…
Q: M Inbox (53,887) Answered: 4. F C Search Textbo PLnwx-GvHgLnU/edit# prmal text Arial 12 + B. 9. nies…
A: Cyanobacteria are photosynthetic bacteria formerly known as blue-green algae. Most are found in the…
Q: Match the bacterium to the correct description. + Pseudomonas aeruginosa A. Gram negative rod. Known…
A: Gram positive bacteria are the bacteria which take up gram stain as they have thick walls having…
Q: 3. Figure 4 shows a section through a cell from a fungus magnified 48,000 times. The section has…
A: Fungi comes under the category of eukaryotes and therefore they contains a true nucleus.The fungal…
Q: What is the correct family of the bacteria image below? (Bases on what was presented in the Lecture…
A: What is the correct family of the bacteria image below? (Bases on what was presented in the lecture…
Q: express some basic evolutionary relationships among groups of microorganisms, plants and animals…
A: An ecosystem is essential to all life. Ecosystems rely on all of their elements to function…
Q: You are a nurse investigating an outbreak of Carbapenem-resistant Acinetobacter baumannii (CRAB), an…
A: An organism that causes disease in its host is known as a pathogen.
Q: It is gram-negative, nutritionally diverse (Photoautotroph, Photoheterotroph, Chemoautotroph, or…
A: Proteobacteria include a wide variety of pathogens. The pathogens are Escherichia, Salmonella,…
Q: Endospore staining
A: Endospores are dormant and resistant structures formed by bacterial cells. They form within the…
Q: Match the expected result (purple, red, or colorless) to the following descriptions of Gram-stained…
A: The bacteria is the unicellular prokaryotic organism that maintains a definite shape since it…
Q: Salmonella typhi Cyanobacteria Jame of Anabaena spiroides nicroorganism Genus species) Morphology…
A: Salmonella Typhi (S. Typhi) are bacteria that infect the intestinal tract and the blood. they are…
Q: What is the correct family of the bacteria image below? (Bases on what was presented in the Lecture…
A: Introduction: Small, single-celled organisms called bacteria exist. Nearly all areas of the world…
Q: Distinguish between morphology and arrangement of bacteria cells please explain well and do not…
A: INTRODUCTION Depending on their shape, bacteria are classified into several types, described below.
Q: Lyme disease (Borrelia burgdorferi) 2. Shape and arrangement of your pathogen Borrelia burgdorferi…
A: Ans 1: - Lyme disease is caused by a bacterium known as Borrelia burgdorferi and rarely Borrelia…
Q: dentify if the statement is True or False. If the statement is false, identify what is incorrect and…
A: Statement 1:- True
Q: Match the expected result (purple, red, or colorless) to the following descriptions of Gram-stained…
A: Bacteria are unicellular prokaryotic organisms that maintain a definite shape since they contain a…
Q: If the steps involving yeast inoculation are not done, what would happen to the process of vinegar…
A: The production of vinegar requires two steps: The initial step involves the production of ethanol…
Step by step
Solved in 2 steps
- https://www.youtube.com/watch?time_continue=2&v=B_lHQSxz9GI&feature=emb_logo Using what you’ve learned from the video, answer the following questions in the spaces provided.1 Death is a major event not only for the person who dies but also for the microbes that inhabit their body. Which of the following statements best describes why? a. All the microbes that were living inside the person’s body die when the person dies. b. Microbial populations grow and spread to different areas of the body after the person dies. c. Microbes in the body have fewer resources after the person dies, which increases competition. 2 Which of the following statements about cadavers (dead bodies) is most likely to be true? a. Microbial communities in and around a cadaver change over time. b. Samples taken from different cadavers always contain the same microbes. c. The microbial community found in a cadaver is very similar to the one found in a living body. 3 After death, gases build up inside the…Bacteria Viruses Protozoa Fungi The name of the organism and category it belongs to The biological drawing of the organism Interesting characteristics of this organism What the organism does that is helpful Who or what benefits from this organism Where you found the information (using APA citation). https://www.bib me.org/apa/film -citationIn order to do electron microscopy the samples had to be specially prepared. Were the cells alive at the time of viewing? Explain why you said yes or no I need help answering this queshtion the answer is with the article and it has to be as short as possible URL: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/
- Your email address (journeyanderson@student.visioncsd.org) will be recorded when you submit this form. Not you? Switch account * Required Prokaryotes are classified by their shape and their cell arrangement. Identify the bacteria in the picture below. * Bacillus Coccus Spirochete VibrioNumerous mechanisms are used by the different eukaryotic microbes for cellular locomotion. Please discuss at least 4 of these mechanisms for locomotion utilized by these cells for movement through their microenvironments. Be sure to state the specific organism (name drop please) that you are referring to and how this locomotion mechanism is used by the cell and by microbiologist for classifying microbial cells.Please write, in paragraph form, how you would identify the organism step by step. Remember to provide as much detail as possible, including but not limited to staining procedures, identification methods and their results. You have been given the final answer (type of organism), now explain to me in detail how you would come to this conclusion Type of organism Topic is : Proteus vulgaris
- MICROBIOLOGY: Microscopic Morphology of Microbes Write your introduction (This includes principles, significance of the study, objectives of the experiment and how the objectives were achieved. This part must also be in the passive voice and past tense. Introduction must be short but packed with relevant content). another: What is the advantage of the Gram stain over the simple stain? What is the theory about the mechanism of the Gram-stain reaction?I BIO-103-LAB-WORKSHEET-3_BACTERIAL_MORPHOLOGY.docx - Trio Office Writer File Edit View Insert Format Styles Table Form Tools Window Help Abç # a a a ab ah & a 三、三军三E Default Style Calibri 12 I 1 I II Guide Questions: Illustrate the different forms of bacteria. 1) Spherical - coccus diplococcus streptococcus staphylococcus mono coccus 2) Rod-shaped bacillus club-shaped bacilli rodswith square ends fusiform bacilli rods with rounded ends 3) Curved rod - spir illa a. rigid form Spirillum vibrio Page 2 of 3 143 words, 1,416 characters Default Style English (USA) + 80% 8:26 AM P Type here to search 13 15 2/6/2021Your answers are saved automatically. Question Completion Status: L A Moving to another question will save this response. Question 9 The domains of life are: Prokaryotes, and Eukaryotes Archae and Bacteria Prokaryotes, Eukaryotes, and Protists Prokaryotes, Archae, and Eukaryotes Bacteria, Eukaryotes, and Archae Prokaryotes, Archae, and Protists L A Moving to another question will save this response.
- You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTPlease answer fast 1) This member of class Alphaproteobacteria has a unique method of moving around and orienting itself within its environment. This organism contains magnetosomes which allow it to respond to magnetic fields. Group of answer choices 1/ Flavobacterium johnsoniae 2/ Mycoplasma genitalium 3/ Thiomargarita namibienus 4/ Magnetospirillum magnetotacticum 2)This member of class Saccharomycota can use either aerobic respiration or fermentation to metabolize glucose. Group of answer choices 1/ Flavobacterium johnsoniae 2/ Magnetospirillum magnetotacticum 3/ Saccharomyces cerevisiae 4/ Staphyloccous aureus 3)This bacterium can live in viscous environments. It uses its flagella to move around and to stick to tissues. Group of answer choices 1/ Magnetospirillum magnetotacticum 2/ Helicobacter pylori 3/ Flavobacterium johnsoniae 4/ Mycoplasma genitalium 4)This member of Class Gammaproteobacteria lives in oxygen-poor environments and detoxifies…https://www.youtube.com/watch?v=3ivMSCi-Y2Q&feature=emb_logo https://www.youtube.com/watch?v=q2nWNZ-gixI&feature=emb_logo what do bobtail squids and bacteria have in common? How can this knowledge be applied to the medical field?