Q: To define: The term allosteric enzyme and allosteric effector.
A: A metabolic pathway is a series of interconnected biochemical reactions that convert a substrate…
Q: Which antibiotic would you want to take based on the results found in the table? I would take…
A: Zone Of Inhibition: A Zone of Inhibition Test, commonly known as a Kirby-Bauer Test, is a…
Q: Amari suspects they have a condition called metatarsalgia. This term is related to the term…
A: Introduction Metatarsalgia is a painful and inflammatory condition affecting the ball of your foot.…
Q: To examine: Whether the statement, "If an oxidation occurs in a reaction, it must be accompanied by…
A: When an electron is removed in a chemical reaction, the state is known as oxidised, and when an…
Q: Topic:Excretion in animals Distinguish isotonic, hypotonic and hypertonic solution from one another…
A: Answer :: Isotonic solution :- Both the solutions, in and out of the cell have same water and…
Q: 2. Label the muscles on the dorsal and ventral sides of the frog. Write all the answers in the next…
A: Frog contains many muscles on their dorsal and ventral sides. These muscles are needed to perform…
Q: 4. Use the words presented in below to create a concept map illustrating the relationships among…
A: All these terms mentioned in the question, are related to the isolation, cultivation, and…
Q: A. UDP- galactose-4 epimerase is lacking for patients with type 1 galactosemia B. Classic…
A: Galactosemia is a condition that affects the way the body processes galactose, a simple sugar. There…
Q: 18. During cell signaling, tissue X sends a signal to tissue Y, tissue Y responds but then sends the…
A: Cell signaling can be categorized into four types based on the distance that the signal travels to…
Q: Kim works as a dog trainer. She wants to apply the methods of science inquiry to improve her…
A: Introduction Injury is defined as the physical harm that occurs when the human body is exposed to…
Q: In a hypothetical population, a genetic anthropologist has gone in and determined the following…
A: Given data, Unattached earlobes - dominant - E Attached earlobes - recessive - e Genotype…
Q: What is the course of a typical acute infection? O a. Virus entry, innate defenses, memory response,…
A: During the acute infection , first virus enters into the body and then undergo into the period of…
Q: QUESTION 1 You are studying a mutant strain of e.coli. When you add lactose to the media of this…
A: Lac operon is the segment of DNA which is involved in the breaking down of lactose into glucose in…
Q: This blood vessel carries blood away from the heart. O A. Artery O B. vein O C. venule O D.…
A: Blood circulate throughout your body with the help of certain vessels known as blood vessels. Thus…
Q: Amount of ddt per organism
A: DDT, or dichlorodiphenyltrichloroethane, is a colourless, odourless, and tasteless crystalline…
Q: To describe: The competitive and noncompetitive inhibitors and also describe the way in which they…
A: Inhibitors are molecules that prevent enzymes and substrates from binding together. Inhibitors work…
Q: 5. Provided with the following data, compute the corresponding CFU/ml of the original culture.…
A: Introduction For CFU count the average no. of colonies chosen is 30-300. Above this range, the…
Q: organs of reptiles and birds
A: The biological system of an organism's reproductive system, often known as the genital system, is…
Q: e. None of these 8. An earthquake hits the bay area, and you and your family have the choice of…
A: b. eat chicken then the beans beacause chiken can't be stored for longer days in earthquake…
Q: Order the following events of the cell cycle, starting with G1 as the first event. Each answer…
A: Answer :- In event of the cell cycle , starting with G1 as the first event and rest are as follow :-…
Q: To examine: Whether the statement "Horizontal gene transfer is more prevalent in single-celled…
A: Cells make up all living organisms on the planet. "Life's structural and functional unit is defined…
Q: The Ardipithecus ramidus specimen, nicknamed Ardi, was a great find because it contained a large…
A: Ardi It refers to the fossils of Ardipithecus ramidus. It is considered as an early human-like…
Q: Which of the following are shared-derived* characteristics of the species found within the Genus…
A: Shared derived characters among Genus Paranthropus.
Q: Suggest one possible way to effectively conserve declining diversity
A: Ecosystems provide foods, medicines, and energy, they regulate nutrient recycling and waste, they…
Q: Identify each of these stages of the cell cycle. Each answer option should be used once. 1 5 3 4 1 […
A: Prophase- chromosome condense and becomes visible. Metaphase- chromosome are lined up at the…
Q: Heart muscle works hard and therefore consumes much ATP. Which organelles would you expect to be…
A: Heart muscle or cardiac muscle signifies the thick middle layer of heart, which is known as…
Q: To explain: The extraordinary mutation resistance of the genetic code argues in favor of its origin…
A: The hereditary unit of most organisms is DNA. It is transcribed into mRNA by a transcription…
Q: Describe how the environment has a significant impact in plant growth and development.
A: Plans require some environmental or external factors to synthesis food for their survival. These…
Q: What can happen if you get an antibiotic-resistant infection? O You may have a longer-lasting…
A: The correct answer choice is - all of the above.
Q: Select the correct statement about cardiac output. A slow heart rate increases end diastolic…
A: Introduction Cardiac output is calculated by multiplying the stroke volume by the heart rate. The…
Q: Name the airways in the mammalian lung. What are their functions? How does air enter and leave the…
A: In mammal the respiratory system exchanges gases with the surroundings. Once air enters through the…
Q: Flatworm parenchyma cells that are stem cells: O A. pigment cells B. fixed parenchyma cells O C.…
A: Introduction Any phylum of flatworms, also known as platyhelminths. Platyhelminthes are a group of…
Q: What are B and T cells and how do they relate to lymph nodes? 2. What are cell-surface antigens? How…
A: Introduction:- The remarkable specificity of adaptive immune responses is due to lymphocytes.…
Q: 13. Directional selection means that a. The environment controls which organisms will survive. b.…
A: Introduction Selection:- It is the preferential survival and reproduction or preferential…
Q: HELP EMAIL • a DNA ladder with markers every 200 bp (DNA Ladder) • the resulting restriction…
A: Restrictions enzyme or endonuclease are the enzyme which cleaves the DNA at specific restrictions or…
Q: To predict: The reproductive success of captive-bred females released in the wild.
A: Our efforts to boost food production rely heavily on biological principles applied to animal…
Q: What are the similarities and differences between community ecology and population ecology?
A: Introduction :- The study of concerns of what variables affect population and how and why a…
Q: Compare and contrast the advantages and disadvantages of selective breeding versus genetic…
A: Genetic engineering or recombinant DNA technology is a process where we modify a particular gene of…
Q: Label completely the cross-section of frog skin and alligator skull.
A: Frog Frog is mostly aquatic leaping amphibians having thin bodies, smooth wet skin, and strong long…
Q: To determine: Whether landscape biology and restoration ecology are examples of in situ or ex situ…
A: The biological variety and variability of life on Earth is usually defined to stated as…
Q: A very large population of randomly-mating laboratory mice contains 35% white mice. White coloring…
A: If the alleles of a gene are different, one allele will be expressed which is the dominant. The…
Q: When molecular biologists carry out a PCR, they have a range of different DNA polymerase enzymes on…
A: Polymerases α, δ, and ε are most active in dividing cells, suggesting that they function in…
Q: 2 -3 Which cranial nerve innervates the eye muscle labeled 2 in this diagram?
A: Introduction: Six cranial nerves innervate in eyes.motor, autonomic and sensory. The muscles…
Q: Fetal hemoglobin has a higher affinity for oxygen than mother's hemoglobin due to inability of fetal…
A: Hemoglobin is a protein with four polypeptide chains. It plays important role in the transport of…
Q: Describe or draw the process of creating a vesicle from an ER membrane OR fusing a vesicle with the…
A: A vesicle is a tiny cell structure made up of fluid and a lipid bilayer. Exocytosis, phagocytosis,…
Q: Quantitation of the evidence DNA extracts from the Mockingbird Lane case return the following…
A: ANSWER;- Item 1 and Item 4.
Q: The later gracile australopithecines had larger brains than the Australopithecus afarensis. True…
A: Introduction Human evolution:- It is the process by which human beings developed on Earth from…
Q: ACTIVITY 27.1 Cells are divided to produce another cell. It is either mitosis or meiosis. Let's…
A: MITOSIS MEIOSIS Kind of cell Somatic cell Gametes / sex cells Number of cell division…
Q: Because the Laetoli footprints date to 3.6 mya and they are clearly made by a bipedal hominin, it is…
A: Introduction Bipedalism:- It is a form of terrestrial locomotion where an organism moves by means of…
Q: After several days of starvation, the ability of the liver to metabolize acetyl-CoA via the citric…
A: During starvation, glycogen stored as a fuel is used up by the liver to supply the required amount…
Step by step
Solved in 2 steps
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlymRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
- Complete the complementary strand: mRNA transcription ATTCGAGGCTAAGive the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCTUse the genetic code to answer these questions. Second letter U A G UCU) UCC UGU) Cys UAU Tyr UGccys UGC. UUU U Phe UAC UUC U UUA Ser }Le UCA UAA Stop UGA Stop | A Leu UUG. UCG UAG Stop UGG Trp G CCU ССС CAU1 CGU CGC Arg CUU CÁCHIS Pro CUC Leu CUA ССА САА CGA CCG CAG Gln CUG CGG AAU Asn AGU AUU ACU Ser AUC ile A AUA А ACA AAC J Thr AAA Lys AGC JArg AGA AUG Met | ACG AAGJ AGG. GCU GUU) GUC G GUA GAU Asp GACJ GGU) GGC Gly GCC - Val Ala GCA GAA GGA GCG Glu GAGS GGG GUG G Q3.1 Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAATTТAAATTT - 3' Template strand 3'— АТАСТТТАААТTТАAA - 5' Enter your answer here First letter DUAG Third letter DUAG
- Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9…5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationArg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’
- Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino AcidIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.