The sequence of one strand of DNA is ACCTGC. What is the sequence of the complimentary strand of DNA?   A. ACCTCG   B. TGGACG   C. UGGAGC   D. ACCUGC

Q: Given a DNA strand with nucleotide sequence 3’ CCGTTACCGC 5’, how many hydrogen bonds are formed…

A: DNA (De-oxy ribonucleic Acid) consists of four nitrogenous bases, namely, Adenine (A), Thymine (T),…

Q: Identify the sites of lagging strand synthesis. Select all that are true. 5 O a. A O b. C O c. B O…

A: Introduction:- The process of replicating a double-stranded DNA molecule into two identical DNA…

Q: Which type of mutation involves only one base pair? a. insertion b. deletion c. inversion d.…

A: A mutation occurs when DNA molecules are copied or replicated, resulting in DNA variants that can be…

Q: transcribed RNA

A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…

Q: Identify whether the base sequences represent only a DNA sequence, only an RNA sequence, or either a…

A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…

Q: Label each statement as pertaining to DNA, RNA, or both. a. The polynucleotide is double stranded.…

A: Statements (a) and (c) are pertaining to DNA, statement (d) is pertaining to RNA and statement (b)…

Q: Which of these is a polymer made of nucleotides?  a. RNA polymerase  b. CAS9 c. restriction…

A: A nucleotide has three parts: a phosphate group, a 5-carbon sugar, and a nitrogenous base. They are…

Q: Question 31 In an analysis of the nucleotide composition of double-stranded DNA, which of the…

A: DNA is the genetic material found in most living organisms. It is made up of phosphate groups,…

Q: Which protein directs the recombination exchange with a DNA that has failed a complete DNA…

A: DNA unwinds and the two strands detach at the "replication origins" a little at a time, like a…

Q: If a DNA strand has the sequence ATGCGATCCGC thenthe sequence on the complementary DNA strand is…

A: Answer is b.) TACGCTAGGCG.

Q: Give typing answer with explanation and conclusion

A: The DNA or deoxyribonucleic acid is the genetic material in living organism that is composed of…

Q: Which of the following is the complementary strand of a DNA strand made up of 32% cytosine?    A.…

A: Two strands of DNA are complementary to each other , if we know the sequence of one strand, we could…

Q: Choose the combination of answers that most accurately completes the statement.Which of the…

A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material that contains thousands of…

Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: A double-stranded molecule of B DNA contains 340 nucleotides. What information do you know based on…

A: Chromosomes are carrier of deoxyribonucleic acid (DNA). DNA is the genetic material. Each species…

Q: Explain the difference between the coding strand and the template strand in DNA

A: DNA is the hereditary material of the cell which serves as the blueprint for various cellular…

Q: What is the approximate diameter of double helix of DNA? A. 2000 pm B. 3400 pm C. 800 pm D.…

A: Detailed explanation: Option A is CORRECT. DNA molecule has a diameter of  2000 pm.diameter is the…

Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…

A: DNA and RNA are two nucleic acid polymers found in all living cells. Both are made up of nucleotide…

Q: If one of the strands in DNA is made up of 10% guanine, what will be the composition of the DNA? A.…

A: The base complementarity of DNA is defined by the Erwin Chragff rule. Which states that in DNA there…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Enzymes or proteins involved in DNA repair include a. RAD52 b. RuvA c. UvrA d. MAPK

A: DNA repair is considered as a process in which any kind of damages is eliminated out.

Q: The enzyme ________ separates the TWO DNA strands of the double helix.     a. helicase   b. ligase…

A: Deoxyribonucleic acid (DNA) is the functional genetic information-carrying molecule present in cells…

Q: What term is used to describe the fact that the 5' end of one strand lines up with the 3' end of the…

A: DNA stands for deoxyribonucleic acid. It is a genetic material present in the cell.

Q: A DNA nucleotide triplet that codes for the amino acid alanine is a. CCA b. CGG C. CCU d. CGU

A: Introduction The molecule that carries the genetic information necessary for an organism's growth…

Q: Why are mutations more likely to occur in repeated DNA sequences? a. These bases are unstable b.…

A: Repetitive DNA sequence Repetitive DNA refers to the stretches of DNA that repeat throughout the…

Q: What are major functions that DNA polymerase performs?   A. unzips the DNA strand and makes the new…

A: The process of replication of DNA is catalysed by various sets of enzyme namely: DNA polymerase, DNA…

Q: The transcription factor that unwinds DNA to expose the template strand Group of answer choices

A: The conversion of DNA's genetic information into mRNA takes place by a process known as…

Q: Match each DNA component to its corresponding point of attachment. 1. carbon 3' 2. carbon 5' 3.…

A: Deoxyribonucleotide (DNA) is a molecule containing all the genetic information needed to make each…

Q: Which part of the DNA is broken in a double strand break?       a.  Hydrogen bonds between bases…

A: Double strand break in the DNA happens when DNA is being exposed to some irradiating agents or…

Q: There is segment of double-stranded DNA that is found to have a total of 140 bases. If 45 of those…

A: DNA( deoxyribonucleic acid )  is two stranded ladder like structure which contain four bases :-…

Q: Choose the combination of answers that most accurately completes the statement.Which of the…

A: Three major steps are involved in polymerase chain reaction are denaturing, annealing and extension.…

Q: Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand…

A: Coding strand - The strand of DNA whose base pairs sequence is identical to RNA transcript base pair…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.