The process where short-chain fatty acids are produced

Q: Akis shaksas katha chaa mehsoos karnak taan, zara karo wazahat?

A: The question has been asked about the sense organs of an individual. We know that, their are…

Q: hi can you please help me review this vedio including vedio topic presented, the information…

A: The video provides a comprehensive overview of the COVID-19 outbreak in Wuhan and raises important…

Q: nqstem 16 abismoro S. chinistros las At comoino yrism worl grimetnco rose isbur Let's Evaluate 1.…

A: Introduction :  A cell cycle is an organised sequence of cellular processes. DNA replication and…

Q: I am a bit confused on why you switched the correct and incorrect statements. Could you clarify?

A: In genetics there are two types of alleles that are in charge of imparting the phenotypic effects on…

Q: Gioe beovres die/ge drde or rlaun HG- tikad Alaa ktat Tiwan prdar cal lele steat i Aart atoe…

A: Since we only answer one question at a time, we’ll answer the first one (flow chart). Please…

Q: Please help me answer this question

A: A compound of hydrogen and carbon, such as any of those which are the chief components of petroleum…

Q: for an in vitro translation reaction. Which one would you leave out? Cell sap containing ribosomes O…

A: In vitro translation is a technique that in which a given mRNA is translated (outide the cell using…

Q: I believe ut should be Asn Ala Val Tyr Ala Arg Met Tyr

A: A peptide is a short chain of amino acid residues linked together via a peptide bond. As per the…

Q: Could u pls write little longer? thanks

A: Drugs affect how neurons use neurotransmitters to send, receive, and process signals. Because some…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: Can you help me the name of the muscle of the label?

A: The muscular system is one of the 11 organ systems present in the human body. There are three kinds…

Q: 21 PS 2F ZS E 22

A: This picture is of Cell division (Anaphase)  Mitosis is a type of cell division in which a cell…

Q: How many unique polypeptides would you expect to see synthesized by an in vitro translation reaction…

A: The correct answer is Option B - 1 According to the question, the mRNA code is poly (AC)n This…

Q: Dermatology - Pronouncing, Spelling, and Dissecting Use the pronunciations to correctly spell the…

A: Introduction Dermatology is a specialty of medicine that focuses on skin conditions and disorders.…

Q: What do their comments mean, with respect to their functions in our bodies?

A: Organ system/ body system is a system which is formed by various organs.   Organ system in human…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: 外 13 A ING 11

A: The given diagram is of the base of skull.

Q: Can you help me with this picture

A: Anatomy is the part of science concerned with the investigation of the design of organic entities…

Q: 5. For the following 3 terms: define, describe, and give an example if possible. a. 3' end b. Uracil…

A: DNA and RNA consist of a complex physical structure. DNA consists of two strands arranged in helical…

Q: 1. Larry Martin and David Burnham (U of Kansas) made their 3-D model of microraptor from a mold of a…

A: Microraptors are small, four-winged dinosaurs. They contain 2 pairs of feathers one in the for limbs…

Q: What is the Fischer projection of the nonulose structure above? H OH H OH HOH HOH H OH HOH H OH HOH…

A: The fischer projection of given nonulose structure is..  fischer projection is 2-D image of 3-D…

Q: I need help asap thanks

A: There are 8 cranial bones in which the Frontal bone is the flat bone comprising of forehead and…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Adding | [ Select ] to the media will increase the germination rate of seeds the type typically…

A: Seed germination is a process in which a plant emerges from a seed under favourable conditions of…

Q: Letter D please what is called!

A: The smallest structural and functional unit of an organism is known as cell which contain different…

Q: Can u answer your qustions

A: Need to find the answers the given questions below with reference to the graph.

Q: im confused, what is the answer?

A: The root system and the shoot system are the two main structures in plants. Every one of these…

Q: G A -J -K AE -F

A: Skeleton is a scaffolding structure of the body which comprises of :-  I ) Bones  II ) Cartilage…

Q: may u break it down a little more please

A: Integumentary system :  Integuments are the largest system of the body. It includes skin and its…

Q: OMY Friendare waiting- me The mall iwith for-unil£L -on-for, at -eo 2 Zeena hdes the bug colleje…

A: The preposition is a very important part of the English language. It is used to show the association…

Q: i can't read that hand writing you suck

A: Dihybrid cross is an essential topic in the case of Mendelian genetics.. In the case of a dihybrid…

Q: B C D E F G H — K

A: This collection of muscles encompasses various regions of the body, each with its unique location…