The process where short-chain fatty acids are produced

Q: can you explain this again in a different way

A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…

Q: hi can you please help me review this vedio including vedio topic presented, the information…

A: The video provides a comprehensive overview of the COVID-19 outbreak in Wuhan and raises important…

Q: nqstem 16 abismoro S. chinistros las At comoino yrism worl grimetnco rose isbur Let's Evaluate 1.…

A: Introduction :  A cell cycle is an organised sequence of cellular processes. DNA replication and…

Q: ER 1ZER TIZER GEL

A: Neurons or nerve cells form the structural and functional unit of the brain and spinal cord. Neurons…

Q: Gioe beovres die/ge drde or rlaun HG- tikad Alaa ktat Tiwan prdar cal lele steat i Aart atoe…

A: Since we only answer one question at a time, we’ll answer the first one (flow chart). Please…

Q: ABCDE u o I

A: The given diagram shows the female reproductive system and the excretory system in humans. The…

Q: * Regaldíng Medicolegal importnce af stab wound A ysually homicidal in origen P Multiple and on…

A: Regarding medicoleagal importance of stab wound:- A) statement is correct  As, most of the stab…

Q: I believe ut should be Asn Ala Val Tyr Ala Arg Met Tyr

A: A peptide is a short chain of amino acid residues linked together via a peptide bond. As per the…

Q: Skilk Check diglhe dliill jS-al 10 LOOK a De mage ana marcn me mmper KO me corecCE TISSUE type.…

A: A group of cells containing similar structures and functions is known as tissues. It is the shape…

Q: 1. Explain the difference between a WBC count and a differentialcount in terms of what information…

A: Hello, as your question has many parts, we will only answer the first three parts for you and if you…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: Instead of Thymine, RNA uses

A: Nucleic acids are made up of 4 nucleotide molecules as there are four nitrogenous bases.DNA or…

Q: Thіs quеstіоn аbоut Bіосhеmіstrу   Whеrе іs АTР bеіng utіlіzеd durіng musclе cоntrаctіоn?…

A: Introduction: The correct choice is Myosine head domains.

Q: Can you help me the name of the muscle of the label?

A: The muscular system is one of the 11 organ systems present in the human body. There are three kinds…

Q: Rearrange the jumbled word and find the correct term and define

A: Scientific terms are used to specifically present a substance or a molecule or an event or a…

Q: Baby monkey favorite food

A: Monkey is a common name that may refer to certain groups or species of the simian mammals of order…

Q: B A- E- A U D E ✓ B ✓ F- vi G- H F G D- ✓ H-

A: The image is of brain and its different parts. Brain is the most important regulatory organ of the…

Q: View this list of hazards and select those that you recognise from the image above Icy road…

A: First aid is the first and the immediate response and help given to any person who is suffering from…

Q: What do their comments mean, with respect to their functions in our bodies?

A: Organ system/ body system is a system which is formed by various organs.   Organ system in human…

Q: the aduwantage W hat of Jean Watson Aurgina Theory are on Pahrent A Family ?

A: Nursing care is the field of clinical practice of administration of drug ,patient counselling and…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: 外 13 A ING 11

A: The given diagram is of the base of skull.

Q: قارن بين فحص spt و cpt

A: The Blood Allergy Test (CPT) and the Skin Prick Test (SPT) are two popular tests used to diagnose…

Q: 5. For the following 3 terms: define, describe, and give an example if possible. a. 3' end b. Uracil…

A: DNA and RNA consist of a complex physical structure. DNA consists of two strands arranged in helical…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: BOBBITT LABORATORIES LLNTERN N SARLINA

A: The small intestine is part of the digestive system lying between the stomach and the large…

Q: 8. Define, give an example of, and explain both Catabolism and Anabolism.

A: Metabolism involve mechanism that all living beings require to maintain their bodies. Both anabolism…

Q: Can u answer your qustions

A: Need to find the answers the given questions below with reference to the graph.

Q: What amino acid does the codon AUG code for? OUAG-methionine (MET) UAC-methionine (MET)…

A: There are 64 possible codons, among them three do not code for any amino acid, known as stop codon.…

Q: CH OH CH -Q OH HHHHHHHHH CH CH C-C-C-C-C-C-C-C-C-C-H HO H. HHHHHHHHH CH-CH OH H. H. OH OH H

A: Biomolecules are substances that are present in living beings. The biomolecules are formed of…

Q: may u break it down a little more please

A: Integumentary system :  Integuments are the largest system of the body. It includes skin and its…

Q: OMY Friendare waiting- me The mall iwith for-unil£L -on-for, at -eo 2 Zeena hdes the bug colleje…

A: The preposition is a very important part of the English language. It is used to show the association…

Q: Acrocanthosaurus what is physical description compare to tyrannosaur rex differences of shape, size…

A: Acrocanthosaurus In Greek this means "high-spined lizard". It was a very large theropod which…