The peptidoglycan layer in a Gram-negative cell is typically .008 um thick while the peptidoglycan layer in a Gram-positive cell can be up to 0.00000008 m thick. Which cell type has a thicker layer of peptidoglycan. The Gram negative cell is 1,000x thicker than the Gram positive cell. The Gram positive cell is 1,000,000x thicker than the Gram negative cell. The Gram positive cell is 1,000x thicker than the Gram negative cell. The Gram negative cell is 1,000,000x thicker than the Gram positive cell. The Gram negative cell is 10x thicker than the Gram positive cell. The Gram positive cell is 10x thicker than the Gram negative cell.

of bacteria. The Gram stain works because of differences in the O 1) cell membranes O 2) genetic characteristics O 3) capsules O 4) antigens O 5) cell walls

Please help

Describe the cross - section side view of a Gram - negative cell . Clearly state where the following would be located or write the letters in order of appearance from the outside to the inside . If any of these structures are not present , make sure to leave them out . A ) peptidoglycan ; ( B ) periplasm ; ( C ) porin ; ( D ) LPS ; ( E ) teichoic acids ; ( F ) plasma membrane : ( G ) outer membrane : ( H ) nucleoid

Proteins from which compartment of the bacterial cell are likely to be found in the supernatant following the sucrose shock procedure? SELECT ALL THAT APPLY. Outer membrane Extracellular space Cytosol Plamsa membrane Periplasm

A lab technologist calibrates her microscope and finds that 7 stage divisions are equal to 38 ocular divisions. The entire scale on the stage micrometer is 1 mm long and has 100 equal divisions.  The technologist measures a coccus-shaped cell and determines that the cell is 4 ocular divisions in length.  What is the length of this cell in µm?  Show all calculations.

A bacterial culture that has been pretreated with penicillin to inhibit its peptidoglycan synthesis is split and put into solutions of various concentrations. The same is done with a control culture with no prior penicillin exposure. Which condition is likely to demonstrate the biggest difference in outcomes between the control culture and the experimental culture? Placing the cultures into an isotonic solution Placing the cultures into a hypotonic solution Placing the cultures into a hypertonic solution The control and experimental cultures should show you the same results in every condition

Gram staining is a common technique used to differentiate two large groups of bacteria based on their different cell wall constituents. The Gram stain procedure distinguishes between Gram positive and Gram negative groups by coloring these cells red or violet. Gram positive bacteria stain violet due to the presence of a thick layer of peptidoglycan in their cell walls, which retains the crystal violet these cells are stained with. Alternatively, Gram negative bacteria stain red, which is attributed to a thinner peptidoglycan wall, which does not retain the crystal violet during the decoloring process - s. epidermidis a gram-positve coccus - E. coli a gram-negative bacillus  - C. xerosis a gram-positive bacillus  How does each organism fulfill a specific niche based on the information provided above?

I U Cardo 12 1三 ニ 三 rI TI3 4. 111 I. 5. What are the basic shapes of bacterial cells? What are the basic Know the terms. Which types of organisms have axial filaments? How would classify the following in terms of gram stain reaction and shape and arrangement of the cells Escherichia coli? Staphylococcus aureus? Streptococcus pyogenes? Bacillus anthracis? Do these organisms cause any important diseases? arrangements? you III

add 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentration of bacterial cells in Dilution Tube #1 and Dilution Tube #2? 5. ( ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for the template strand (note: the template strand is the strand that is transcribed). This sequence includes the regions that code for start and stop codons in translation as well as introns and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES. Coding Strand of DNA: +1 Box2 (-25) 3' ....TATAAA........ TACTCGATAGCCGAATGTCTTC CTCAGAC TAA... 5' a) Describe the role of the following in transcription of this DNA strand: a. RNA Polymerase b. Promoters c. Transcription factors d. Initiation, elongation and Termination of the pre-mRNA strand b) Transcribe the above DNA into a pre-mRNA Molecule c) You have just transcribed the above molecule of messenger RNA in the nucleus of a human cell. What types of modifications will occur to this RNA before it leaves the…