Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forwardSelect the correct statement about the trp operon: high levels of tryptophan promotes high transcription of CAP O low levels of tryptophan promote transcription of trp operon genes O high levels of tryptophan stall ribosomes to reduce tryptophan synthesis O high levels of tryptophan promote transcription of trp operon genesarrow_forwardWhat are the operon fusion and the gene fusion? How can they be used for studying gene expression in cells? 1 Fr ▼ T: - - p- A - B I ! 123 !!arrow_forward
- Read the following statements about operons, and mark the FALSE one. O a. Prokaryotes use operons frequently because they are an efficient use of resources O b. The expression levels of the genes in an operon can be regulated individually Genes in an operon are placed next to each other (physically) O d. The genes in an operon share a single promoterarrow_forwardIn the tryptophan operon, if the leader peptide is translated normally A region 2 will pair with region 3 B a rho independent terminator will form. C both a and b D none of the abovearrow_forwardWhat would occur if the repressor of an inducible operon were mutated so it could not bind the operator? Build up of a substrate wihin the pathway controlled by the operon Continuous transcription of the operon's genes Irreversible binding of the repressor to the promoter Reduced transcription of the operon's genes O O O Oarrow_forward
- segment of DNA segment of DNA reproesor profein RHA polymerase RNA polymerase rupraesor profin Dlagram A Dlagram B Which diagram shows a system in which the lac operon genes are NOT going transcribed by the E. Coli?arrow_forwardPlace the components of an operon into the appropriate order Stop codon 2 Promoter Start codon 1 Stop codon 1 Terminator Start codon 2 Operatorarrow_forwardAll of the following statements about the repressor of the lac operon of E. coli are true EXCEPT which one? O A. The repressor is the product of a regulatory gene i The repressor binds to the operator region of the DNA of the lac OB. operon. The repressor is a protein. OC. The repressor interacts with the operator in such a way as to OD. prevent translation of beta-galactosidase. The repressor can combine with lactose to form a OE. complex that will no longer bind to the operator region. QUESTION 32 The amino acid which is a precursor of serotonin is Histidine OA. O B. Tyrosine O C. Glutamate D. Tryptophan O E. none of the abovearrow_forward
- A mutation that inactivates the repressor gene of the lac operon results in (a) the continuous transcription of the structural genes (b) no transcription of the structural genes (c) the binding of the repressor to the operator (d) no production of RNA polymerase (e) no difference in the rate of transcriptionarrow_forwardFigure 16.5 In E. coli, the tip operon is on by default, while the lac operon is off. Why do you think that this is the case?arrow_forwardA binding site for RNA polymerase is called a ________. a. gene c. codon b. promoter d. proteinarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning