The following diagram shows the genetic map of an individual in the region of a gene that has a dominant allele D which causes Marfan's syndrome. The DNA probe hybridizes to a segment of DNA that is known to be about 4 map D d units away from the D/d gene. probe If this person has a child with a normal individual who has been shown to be homozygous for the short DNA fragment and the child is also heterozygous DNA restriction fragments, what is the likelihood that the child will have have Marfan's syndrome? ( Please express your answer as a percentage.)

Q: What is the fingerprint type shown below? *

A: The impression created by the papillary ridges on the tips of the fingers and thumbs is known as a…

Q: Books or refernces on study of Charadrius melodus

A: Charadrius melodus, commonly known as the Piping Plover, is a small shorebird belonging to the…

Q: https://docs.google.com/document/d/1p9yf6Z3bcuD8h1fAg8uJy-ikoR3nMpvsDmClUI2wQT4/edit?usp=sharing…

A: P. A. is a 52-year old man presented with a 2-week history of polyuria, polydipsia, polyphagia,…

Q: Analyze the picture and identify the problem being showed.

A: The picture portrays a healthcare worker wearing a set of personal protective equipment sitting on…

Q: matrix system

A: Introduction:-we can check employees report communication work, where they get to work with…

Q: Label the red arrows

A: Introduction: The brain is the primary coordinating center of the body, allowing organisms to think…

Q: Write about typeB, typeA and typeZ DNA.

A: DNA is deoxyribonucleotide and is made up of nitrogenous base, sugar and phosphate.

Q: What are the disadvantages of Colestipol?

A: Colestipol is classified as bile acid sequestrant which is prescribed for people with hyperlipidemia…

Q: Are there other legitimate means that can be used as a substitute for the polygraph test? Do these…

A: Polygraph test or more popularly known as lie detector test uses several parameters and test to…

Q: How would pyrimidine dimers from the sun effect replication of this gene sequence?…

A: Pyrimidine dimers are the dimers formed between two pyrimidine molecules. Usually it forms between…

Q: Based on the DNA profile provided in the right, who is the father of the child? a. The HUSBAND b.…

A: DNA is the hereditary material in all human beings and other organisms.

Q: Mutations conferring resistance to bactericidal agentssuch as __________ or bacteriophages

A: Bacteria are organisms that have a single cell and are considered the most primitive organisms on…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: Why was half of each plate covered with an index card?

A: UV stands for ultraviolet rays. They are electromagnetic radiation. Ultraviolet radiation mainly…

Q: Rearrange the jumbled word and find the correct term and define

A: Scientific terms are used to specifically present a substance or a molecule or an event or a…

Q: Debate topic for  Pharmaceutical Care is a luxury confined to the private sector

A: Pharmaceutical care comprises  the pharmaceutical industry which sells different kinds of medicines,…

Q: Determine the risks and ethical issues associated with nanotechnology

A: Nanotechnology- The term given to those areas of science and engineering where phenomena that take…

Q: Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding…

A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Q: GENE I DNA AGCCTACG C MRNA Amino Acid

A: The correct sequence of mRNA and amino acid name is shown below.

Q: Provide a summarizing paragraph of the process of translation (no more than 6 lines)

A: Translation is a process by which our cells synthesize proteins. And it's the part of central dogma…

Q: The cytoplasmic granule of RNA andprotein that reads the message in mRNA isa/an ____________________

A: The central dogma of molecular biology describes the flow of genetic information in cells from DNA…

Q: Identify the suffix for process of recording

A: Suffix: It is an affix It is placed after the stem of a word. In medicine it usually indicates: -a…

Q: 1) Write the full procedure in micropieppeting Use past tense and passive voice to write

A: Micropipettes are the tools to handle volumes of liquid in the microliter scale. The air cushion…

Q: How many coding professionals are needed in a 60 bed hospital?

A: Medical coding professional is important to provide code for the various procedures that patient has…

Q: Compare the structure, location, and function of DNA and RNA in a chart below

A: DNA is a is normally been described that it's far the molecule this is decided withinside the…

Q: PDB could assist Dr. in her research endeavor. Explain how

A: Bioinformatics relates to the approach of using computer-related databases and algorithms to…

Q: Styles Editing In cattle, the RR genotype calls for a red cow; the WW for a white cow; and the RW…

A: We are answering first question only. For rest of questions pls Repost.

Q: Copyright by SOMSO, 2010, www.somso.com Identify the highlighted structure.

A: the highlighted portion

Q: What is a carcinoma in situ (CIS)? Edit View Insert Format Tools Table 12pt v Paragraph v d to…

A: Carcinoma in situ is a group of abnormal cells which have not spread beyond the place of their…

Q: Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop…

A: mRNA or messenger RNA contain the genetic codons that must be translated into amino acid chain…

Q: se or plate se or plate NA A ein 5' A I A U כן S E T T R G 3'

A: This table can be filled with  the process of replication,  transcription and translation. During…

Q: Please provide a schematic representation

A: schematic representation of mode of action of interferon type 1.

Q: To speculate means to ask ________________________.

A: In the field of science and all the other disciplines there are numerous tests and experiments being…

Q: Description on the hack Description dermen ripcian reves 13 E

A: The brain is considered as the most complex organs in the human body and also highly evolved in…

Q: What is the chemical nature of the enzyme primase?

A: Primase Enzyme is also known as DNA Primase. These are essential for the replication fork of DNA and…

Q: BOBBITT LABORATORIES LLNTERN N SARLINA

A: The small intestine is part of the digestive system lying between the stomach and the large…

Q: Please fill in missing DNA/RNA/Amino Acid sequences.

A: DNA: DNA is the basic unit of life.The information here  is stored as a code which is made up of…

Q: Dissonant culture nursing

A: Introduction:-  Dissociation in culture makes a person less capable of understanding the new…

Q: Please draw or send me a picture of the structure of DNA and label the parts. Thank you very much.

A: Deoxyribonucleic acid: DNA is a genetic material that is present within the nucleus. It was…

Q: What is the major target of the anti-inflammatory drug Aspirin (salicylate)?

A: Aspirin is an anti-inflamatory drug that is commonly used for the treatment of reducing pain, fever,…

Q: GENE G DNA GTCGTCTII MRNA Amino Acid

A: The DNA is transcribed into the RNA by the process of transcription while the RNA is translated into…

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.