The following diagram shows the genetic map of an individual in the region of a gene that has a dominant allele D which causes Marfan's syndrome. The DNA probe hybridizes to a segment of DNA that is known to be about 4 map D d units away from the D/d gene. probe If this person has a child with a normal individual who has been shown to be homozygous for the short DNA fragment and the child is also heterozygous DNA restriction fragments, what is the likelihood that the child will have have Marfan's syndrome? ( Please express your answer as a percentage.)

Q: Duplications produce extra copies of genes that can mutateindependently of one another and adopt new…

A: Genes carry coded genetic information in the form of specific nucleotide sequences. This specific…

Q: DNA polymerases used in PCR _______.

A: The polymerase chain reaction (PCR) is a technique in which millions of copies of the desired DNA…

Q: Create the complementary DNA strand: AGC-CGA-CCA-TTA Your answer

A: Complementary DNA It is DNA synthesized from a single stranded RNA template in a reaction catalyzed…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: Can you help me identify A, B, and C?

A: Glands are collections of one or more cells that secrete signaling molecules like hormones. An…

Q: Write down the name of one genetic disease that has the potential to be cured through gene therapy.

A: Genetic diseases are the disorders due to defective genes present in an organism. The  genes present…

Q: Write a report on the controversy over NgAgo gene-editing along with your personal opinion?

A: Genome editing is a molecular biology tool which scientist uses to edit the genome of an organism to…

Q: what are some of the healthcare code systems in the United States?

A: Healthcare codes are the codes that are applied in the hospital or community so that the emergency…

Q: Identify when in a crime scene DNA may become mixed.

A: Blended DNA contains DNA from at least two givers, intensifying DNA investigation by joining DNA…

Q: Transcribe the strand into MRNA: CTA-ATA-AAA-CGG Your answer

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Create the complementary DNA strand: ACC-GCC-TAG-GCA Your answer

A: Complementary DNA (cDNA) is a copy of DNA from the mRNA molecule produced through a reverse…

Q: Why was it necessary to soak the gel in hydroxide before performing the blot?

A: Gel electrophoresis is a technique which is used to separate the molecules based on the size of the…

Q: 5'--AUG UCG UAC ACU GCG --3' Make a change in this sequence. Write a different version of this…

A: Given  mRNA sequence  5' AUG UCG UAC ACU GCG 3'   Mutation  The sequencial change in the nucleotide…

Q: Why were you able to see the DNA after adding the ethanol?

A: Introduction :-DNA contains information needed to create proteins, which are other big molecules.…

Q: Your lab partner arrived late to class on the day you started your fetal pig dissection. you've…

A: Dissection is the process of cutting apart or dismembering the parts of the body of a deceased…

Q: gene cloning application

A: Gene cloning is the process in which any gene of interest is amplified, that is, several copies of…

Q: Discuss the advantages of standardized documentation forms ?

A: Nursing documentation is a process in nursing practice where the nurse writes and records the health…

Q: Create the complementary DNA strand: GCG-CAT-TAC-ATG Your answer

A: Complementary DNA It is DNA synthesized from a single stranded RNA template in a reaction catalyzed…

Q: What are the enzymes involved in trascription

A: Transcription is the process of synthesis of mRNA from the DNA strand. It takes place inside the…

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…

Q: What does "indel" stand for? Group of answer choices internal/deleterious insertion/deletion…

A: Indel is a term related to molecular biology and is responsible for causing small variation in the…

Q: The national DNA database in the United States hasstandardized on ___________ STRs for entry into…

A: The balance between the justice system's interest in prosecuting criminals and citizens' right to…

Q: Restriction Enzymes with LongerRecognition Sites Produce Larger _______ Fragments

A: The restriction enzyme is the molecular scissors that cut at a specific site. These are naturally…

Q: what is abNormal excision?

A: Excision refers to the act of removal or cutting out something.

Q: Why was it risky for the chinese scientist to change the twin’s genome sequence?

A: It was risky for the chinese scientist to change the twin's genome sequence as it may lead to more…

Q: Introduction for the forensic PCR lab report.

A: PCR in forensics has many uses. It involves the usage of a technique known as DNA typing or DNA…

Q: EboV from Guinea pig Reference DNA Sample            mRNA           Protein

A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…

Q: What does "long form" mean when reffering to medical terminology?

A: Medical terminology uses precise language to describe human body parts,components, it's actions,…

Q: What are contiguous fragments ?

A: Using complementary sequences that have been synthesised & combined to create a mixture of…

Q: Why does microbial polypeptide need fold into a 3D protein in order to become functional? Explain in…

A: There are four levels of protein structure  depending on the degree of complexity in the polypeptide…

Q: What is unknow ID?

A: An unknown ID is the one where the identity of the person is hidden or non recognizable.

Q: Besides real time PCR, Shania will also be using other variations of PCR; Multiplex PCR, Reverse…

A: Multiplex PCR used in  temperature-mediated DNA polymerase in a thermal cycler.    Multiplex PCR is…

Q: Does this source pass the CRAPP test? In what way?…

A: Approach to solving the question: Detailed explanation: Examples: Key references:Literature

Q: Did Wat son and Crick steal Rosalind Franklin's data?

A: Intellectual theft and plagiarism are serious accusations in the academic world. Plagiarism is…

Q: What would you use the following programs for: Blastn Blastp Tblastn Global alignment CD-search Pfam…

A: Gene prediction is one of the most important parts of bioinformatics. Finding genomic DNA areas that…

Q: DNA mRNA Amino Acids ATC-TAC-AGC-TTC-CCG-TGA-ACT

A: DNA (deoxyribonucleic acid) is the genetic material present inside the cells of all living…

Q: sequence PCR

A: PCR or Polymerase chain reaction is a method to apply to make billions of copies of specific DNA…

Q: What is Cantle’s line?

A: Liver is a organ which is present exclusively in vertebrates. Its function is detoxification of…

Q: Sequence morgans experimen

A: According to the question, we have to explain the sequence of Morgan's experiment. So, let us have a…

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.