The figure below shows differential methylation patterns for various genes in samples of 2 embryonic stem cells (ES), 5 induced pluripotent stem cells (iPSC), and 4 somatic cells. Some genes were not successfully reprogrammed. Use this figure to answer the following question. which of the following is the most accurate statement about the figure? - The genes in regions A, B, and C, all seem to be expressed in embryonic stem cells, and are silenced primarily in adult cells. - The genes in regions A, B ,and C are active in embryonic stem cells. - HDACs may be acting on genes in regions A, B , and C in the ES cells. - All of the iPSC cells are safe to use in therapy.

Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr  - do it on this format

Is phosphate H2PO4 non polar or polar

sucrose + acid ------->

MAP= CO x TPR / 80  I don't understand the value of TPR how do I get this number?

Amino acid +Amino acid >Dipeptide +______

draw a punnett square for ggBB and GGBb.

First letter U C A UUU UU JUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG ] Phenylalanine UCU (Phe) UCC UCA UCG Leucine (Leu) Leucine (Leu) Isoleucine (Ile) Methionine (Met) Valine (Val) CCU CCC CCA CCG b) lysine c) methionine d) tryptophan ACU ACC ACA ACG GCU GCC GCA GCG C Second letter Serine (Ser) Proline (Pro) Threonine (Thr) Alanine (Ala) UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG ] Tyrosine (Tyr) Stop Stop Histidine (His) Glutamine (Gln) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) UGU UGC UGA Stop UGG Tryptophan (Trp) CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG ] 1. List the mRNA base codons for the amino acids listed below. 2. a) aspartate: Cysteine (Cys) Serine (Ser) U C Arginine (Arg) A G Arginine (Arg) U C Glycine (Gly) A G U C A G U MCAG А

How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa   Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…

What does the “=“ mean when used in a macromolecule when written out.