The end result of BOTH transcription and translation of the DNA sequence AAGCTGGGA would result in? O an MRNA strand with the sequence TTCGACCCT O an MRNA strand with the sequence UUCGACCCU a sequence of three amino acids linked by peplide bonds a carbohydrate in the form of a polysaccharide

Q: Which of the following statements about RNA are true?

A:

Q: Which statement best compares a carbohydrate and å O The sequence of monomers in a carbohydrate…

A: Living organisms, including humans, are made up of a variety of complicated biomolecules. The major…

Q: When a protein is being assembled in the monosome, the bond that forms between a newly added amino…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…

A: Nucleic acids are one of 4 biomolecules. Two types of Nucleic Acids are there which are DNA and RNA…

Q: The structure below is a fragment of what molecule? NH₂ NH, OP.OCH, OPOCH, oroc, QPOCH, O DNA ORNA O…

A: There are two kinds of nucleic acids DNA and RNA. DNA is double started molecules and RNA is a…

Q: 3 ‘  TACGCCAGTGGTTCGCAC  5   Give the base sequence of the complementary DNA strand.  Give…

A: Base sequence of template strand this 3 ‘  TACGCCAGTGGTTCGCAC  5 is  5' ATGCGGTCACCAAGCGTG 3'   mRNA…

Q: Figure out which RNA and DNA would code for the following sequence of amino acids (multiple answers…

A: The transcription is the process by which RNA is generated from the DNA template. This process…

Q: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3-ТАССТТААСCGTACCAAATGGGCACTACСА-5'

A: TRANSITION MUTATIONS  These are mutations that occur due to the substitution of a pyrimidine base by…

Q: The base sequence of one DNA strand is given. Use base pairing rules to give the other DNA strand.…

A: The base pairing rules are: G is replaced by C C is replaced by G A is replaced by T and T is…

Q: Describe the covalent structure of an amino acid. Then describe the 4 levels of protein folding.…

A: Biomolecules or biological molecules are the molecules that make up an organism and are required for…

Q: Some events that take place in proteins synthesis are shown below: A. peptide bonds are formed B. a…

A: Protein synthesis involves transcription and translation. Transcription involves three steps…

Q: In the DNA  sequence,the bottom strand is a template strand.if the base pair

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: Chemistry The soybean-like plants on planet 20170113 also have a globular heme-containing protein…

A: Alpha helix is a regular secondary structure formed by proteins. Each turn of an alpha helix is 5.4…

Q: The process of transcription and translation help to crate which type of macromolecules

A: Given: To find which macromolecule is produced during the process of transcription and translation…

Q: The function of a gene is dictates the primary structure of a protein dictates the nucleotide…

A: Proteins :  Primary structure of proteins is the sequence of amino acids in a polypeptide chain.…

Q: 2 1] Amino acids are joined fogether into a protein chain by wfrnich of the following a transfer RNA…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…

A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…

Q: Conjugated proteins which are a combination of amino acids and carbohydrates O A. nucleoproteins OB.…

A: Based on the composition, proteins are of two types, simple and conjugated proteins. The simple…

Q: Draw the structure of a dinucleotide formed by joining the 3'-OH group of dGMP to the 5'-phosphate…

A: Here is a structure of the dinucleotide formed by joining the 3'-OH group of dGMP to the…

Q: What property of nucleic acids do Phil Sharp's experiments take advantage of?

A: Nucleic acid are considered to be macromolecules and biopolymer which is very essential for all…

Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…

A: The genes are the segments of DNA which carries information for the synthesis of the functional…

Q: Assume you want to make and study fragments of a protein. Would you expect that any fragment of the…

A: Proteins are the polymers of amino acids.

Q: nucleotide sequence has providen to you, you have only the name of source organism. - how will you…

A: For finding the nucleotide sequence for proteins first Use the NCBI BLAST service to perform a…

Q: is a sequence of DNA that codes for a specific protein.

A: Genes are the unit of genetic information and occupy a specific position on a chromosome. Genes are…

Q: Which of the following is/are the fundamental difference/s between RNA and DNA? O the sugars only O…

A: DNA stands for deoxyribonucleic acid, where as RNA stands for ribonucleic acid. These are the…

Q: A protein has the sequence of amino acids shown below. Construct a mRNA molecule that could code for…

A: Introduction  Amino acids are the organic substances which have amino and carboxylic acid functional…

Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…

A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…

Q: A IC B

A: Introduction Nuclear Overhauser Enhancement Spectroscopy (NOESY) is a technique that graphically…

Q: Where is information stored in DNA? O In the carbons of deoxyribose sugar O In the order of the…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms that is present in the…

Q: In the space below draw a dipeptide composed of lysine and glutamic acid bound together by peptide…

A: Amino acids are the building blocks of proteins. There are 20 amino acids that join together by…

Q: If all you know about a single stranded nucleic acid is that it has 30% Uracil, then which of the…

A: DNA or deoxyribonucleic acid is the double stranded helical structure and the genetic material in…

Q: AGMP and ADP are different in all the following ways except O the nitrogen-rich base the type of…

A: The nucleotide is the monomer unit of the nucleic acids. These help to form the DNA, whereas…

Q: Which of the following is an RNA nucleoside?

A: Nucleosides- these are the compounds which contains only sugar and base and no phosphate groups are…

Q: Which lettered subunit is the nonreducing end? CHOH CHOH A CHOH CHOH -CH2 CHOH CH OH `CH он 3 CHOH…

A: Non reducing end of a polysaccharide can be defined as the end that do not possess any acetal or…

Q: Peptidoglycan, part of the bacterial cell wall, uses a polysaccharide chain with strong beta…

A: Polysaccharides are carbs made up of a lot of monosaccharides that are joined together by O…

Q: The primary structure of proteins results from choose the best answer) O assistance from chaperonin…

A: Protein is a polymer of amino acids joined by peptide bonds.

Q: How does the coplanar nature of the peptide bond impact the overall structure of D O a. a. It…

A: A peptide bond is an amide type of covalent bond linking two consecutive alpha-amino acids as shown…

Q: The sugar of one nucleotide is attached to the phosphate of another nucleotide through a bond. ester…

A: The chemical bond is the linker or attraction of one molecule to another molecule which in turns…

Q: binds to proteins called histones. Based on your knowledge of DNA (negative charges along the…

A: Histones are composed of mostly positively amino acid residues. The positive charges allow them to…

Q: Which is not true of both ribonucleotides and deoxyribonucleotides?     Both have a phospoether…

A: Nucleic acids are the carrying molecules of the cells and act as an inherited characteristic of the…

Q: Protein synthesis takes place much more slowly in eukaryotes than in prokaryotes. Suggest a reason…

A: Translation is the process that involves the synthesis of an amino acid chain or protein from mRNA…

Q: e quaternary structure of a protein results from oose the best answer)

A: Introduction:-   The spatial arrangements of various tertiary structures of proteins gives rise to…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.