The egg of a fish is what type of chordate egg and why? a. isolecithal b. telolecithal with total cleavage c. telolecithal with meroblastic cleavage
Q: Meaningful evolution occurs when __________. ○ a heritable trait affects survival and fitness ○ a ...
A: Evolution is the change in the characteristics of a species over several generations and relies on t...
Q: Select all the characteristics that apply to BACTERIA but not Eukaryotes. □ lack membrane bound-org...
A: Introduction: Bacteria is a single celled prokaryotic organism. Their cell structure is simpler than...
Q: 1. define inheritance, genes, alleles, and other basic terms used in genetics. 2. execute the basic...
A: It was during the mid-nineteenth century that headway was made in the understanding of inheritance. ...
Q: Human somatic cells have 46 chromosomes. Are the cells different in any way from the parent cell and...
A:
Q: If the purity of DNA sample is below 1.8 A260/A280, where did the protein contamination come from?
A: The absorbance ratio at 260 nm & 280 nm is used to determine the quality of DNA & RNA. A ra...
Q: Describe safety measures put in place for genetic modification.
A: The Food and Drug Administration (FDA), Environmental Protection Agency (EPA), and Department of Agr...
Q: Which of the following are incapable of undergoingmitosis?a. osteoblasts and osteoclastsb. osteocyte...
A: Introduction: Bone tissue is composed of four types of the cells which are osteocyte, osteoblast, os...
Q: Compare the structures of DNA and RNA.
A: Nucleic acids are the most important organic compounds found in all living beings. The three major c...
Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical pro...
A: ANSWER;- Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content = 56...
Q: Why are the elements found in the I=P x A x T important in terms of them having an impact to our env...
A: Any organism cannot survive in isolation. It is surrounded by a number of biotic and abiotic factors...
Q: are the gene pairs in non allelic interaaction, recessive epistasis independently segragating?
A: Epistasis:The interaction of genes that influence phenotype" Epistasis is a phenomenon in genetics ...
Q: In your own words, kindly give the function and allowable limit (if applicable) of each of the follo...
A: Beef cubes- Beef cubes are high in protein and helps to build muscle. It prevents iron deficiency an...
Q: Explain the concept of electrophoresis.
A: Introduction Genetic engineering is the process of altering an organism's genetic makeup using recom...
Q: Q6.1. What is the founder effect? Sampling error that occurs during the establishment of a new popul...
A: Introduction :- The founder effect is the loss of genetic variation that happens when a new populati...
Q: Question 5
A: Answer to Question 1: - Sequence of passage of molecule for filtration in kidney: - Blood> Capill...
Q: If Marine communities dominated during the Early Paleozoic, why move to land? What would an organis...
A: Paleozoic era was a major interval of geologic time that began 541 million years ago and ended about...
Q: 3. Cross a man with type B heterozygous blood with a woman with type O blood. What are the possible ...
A: ABO blood group is an example of multiple allelism. Co dominance are also seen in blood types when b...
Q: you were trying to locate where a gene resided on a chromosome, you would be looking for the gene's ...
A: Phenotype is the expressed character trait of an organism Allele is the genetic equivalent of a trai...
Q: 3. Repeat steps I and 2 for an ear of corn that is the result of crossing Homozygous dominant and he...
A: Mendelian inheritance, or Mendelism, is a collection of hereditary notions proposed in 1865 by Grego...
Q: You have a precursor protein that is translated in the cytosol with an N-terminal mitochondrial loca...
A: The mitochondria is a double membrane bound cell organelle that is responsible for energy (ATP) prod...
Q: Humans have respiratory structures from the gut, for fishes, they’re not.
A: The respiratory system of humans consists of, nasal cavity, trachea( wind pipe) , the main bronchus,...
Q: The part of the neuron that is usually highly branched and receives input from other neurons is the ...
A: Neurons are a particular form of cell that carry information messages or signals to and from the bra...
Q: A red blood cell passes by a cell that has done cellular respiration and, therefore, has a high conc...
A: Hemoglobin can be defined as the protein that is present in the blood and is responsible for the tra...
Q: Describe briefly these cells and identify their shapes. The yellow one is the bone under LPO, and th...
A:
Q: Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5' ...
A: The mRNA that is produced by the process of transcription undergoes a modification process in order ...
Q: Trace the flow of hormanes in the adaptive thermoregulation response involving brown adipose tissue....
A: In thermogenesis the production of heat energy in brown any post issue is a component of the homeo...
Q: Some people declare that we shouldn’t worry about endangered species because extinction has always o...
A: Endangered species are those that are thought to be in grave danger of extinction in the wild. Emerg...
Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...
A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC
Q: There are two types of alleles: Type B1 and Type B2 (In total there are 10) Type B1 has 6 Type B2 ha...
A: Introduction : Here, B1 allele = p = homogygous dominant allele B2 allele = q = homogy...
Q: 22
A: Motor neurons are components of peripheral nervous system which conduct efferent impulses from the s...
Q: 1. What is an exocytosis? 2. What is an endocytosis? 3. Explain the types of endocytosis and give ex...
A: Hello, thank you for your questions. But following the guidelines we are providing the answers for f...
Q: A population ecologist might study the effect of an introduced predator on the _________ of particul...
A: Introduction: A predator is an animal that kills and eats other animals. Examples of predators are l...
Q: Research have stated that there are factors that could affect the efficacy and duration of mosquito ...
A: *Mosquitoes are vectors for mamy diseases like malaria and chikungunya abd Zika virus and yellow fev...
Q: Choose any microorganism from the different groups of cellular and acellular and give the scientific...
A: Introduction:- Bacteria, fungus, archaea, and protists are examples of microscopic creatures. Microo...
Q: How are the concepts of "proxy" and "analogy" similar, and how are they used in reconstructions of t...
A: Proxy or equivalent term homologous is a structure inherited from a common ancestor. Analogy or anal...
Q: What is the importance of water, carbon and nitrogen for living organisms? Explain briefly.
A: Importance of water for living organisms:- All animals and plants need water to survive, and the hu...
Q: Consider the following F, individuals in different snapdragon species and the F2 ratios produced by ...
A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is ...
Q: 8. Which of the following is the longest entity O reads contigs O scaffolds O bases
A: These options represent the various size of base sequences.
Q: why are gram-negative bacteria unevenly distributed on a slide?
A: why are gram-negative bacteria unevenly distributed on a slide?. Introduction: Bacteria that do no...
Q: Myosin heads bend when attached to actin
A: Correct option is C Myosin heads bend when attached to actin
Q: If one bit is mutated on the chromosome 11010001, which of the following chromosomes cannot be gener...
A: * Mutations means change in a DNA sequence by altering the bases. *Mutations arise due to mistakes m...
Q: 1. Read the paragraphs below. For each paragraph, write the letter of the diagram from the diagram s...
A:
Q: In a generalized-transduction experiment, phages arecollected from an E. coli donor strain of genoty...
A: Part A. In the question given that - "initially the treated recipient populations placed on a minima...
Q: Suppose a population has two alleles at a particular locus, and individuals with different diploid g...
A: Hardy Weinberg’s principle is the mathematical representation of population analysis which calculate...
Q: Protoceratops how did they defend itself from predators? They hornless Dino and very small. So what ...
A: Protoceratops can be referred to as herbivorous dinosaur that possessed four limbs and was an ancest...
Q: Explain how FRET could be used to monitor the association of Gαs and adenylyl cyclase following acti...
A: How does fret, a sort of fluorescence can be utilised to essentially check Its interaction of the Ga...
Q: During the Paleozoic, many life forms developed hard parts (shells/bones/etc.). Why would it be use...
A: Shelled animals, the majority of which are sea-based, come in a wide range of shapes and sizes. Beac...
Q: _1. It is the important organ that controls thought, memory, emotion, touch, motor skills, vision, b...
A:
Q: During pregnancy, the fetal circulatory system works differently than after birth. Answer the foll...
A: Ductus arteriosus, ductus venosus and foramen ovale get closed and transformed into newborn circulat...
The egg of a fish is what type of chordate egg and why?
a. isolecithal
b. telolecithal with total cleavage
c. telolecithal with meroblastic cleavage
Step by step
Solved in 3 steps
- Draw and describe the different types of egg as to the distribution of yolk they contain. Give examples of chordates that have the said type of egg. Alecithal Meiolecithal Mesolecithal PolylecithalWhich of the following characteristics is not seen in the phylum Platyhelminthes?a. cephalizationb. the presence of a mesodermc. specialization of the digestive tractd. bilateral symmetryMake a table to identify amle and female homologues and describe it common function. Minimum of 7 organs.
- What type of a body plan doescoelenterates, ctenophores andechinoderms have?A. Annelida B. RadialC. Bilateral D. PlatyhelminthesThis is a cross section of Ascaris male and female. Which parts are derived from the ectoderm, endoderm, and mesoderm.Sea urchins exhibit a holoblastic cleavage pattern. What factor contribute to this cleavage pattern? a. The amount/distribution of yolk b. Conditional specification of the vegetal layer by large micromeres c. The angle of the mitotic spindle and its time of formation d. Maternal factors
- In Ascaris, meiosis and oocyte maturation occur at the same time. Describe the stages that oocytes go through as they pass from the ovaries to the uterus in these worms.Distinguish between: telolecithal and homolecithal eggs. Explain with examples of eachWhich statement is true of Spemann’s organizer?a. It is unique to amphibian embryos.b. It arises early in cleavage-stage embryos.c. It secretes morphogens, including the protein called noggin.d. It is found in the dorsal lip region of early gastrula-stageembryos.e. Both c and d are true of Spemann’s organizer.
- The blastopore forms the future anal or cloacal opening in protostomes. O True O FalseWhich among these insects secrete seducin by the male which both attracts andpacifies the untamed female so that a connection is established?A. Bombus lapidaries.B. Periplaneta Americana.C. Eciton burchellii.D. Nauphota cinerae. How would you classify the type of ovariole of the following orders Neuroptera,Lepidoptera, some Coleoptera, Diptera andHymenoptera?A. polytrophic type of ovarioleB. telotrophic type of ovarioleC. panoistic type of ovarioleD. both B and C Which part of the egg is closely associated to the chorion?A. yolk deutoplasmB. vitelline membraneC. nuclear cytoplasmD. periplasm What is the major control centers of oogenesis that secretes ecdysone?A. headB. fat bodiesC. ovariesD. corpora allataDraw and describe the different types of egg as to the concentration of yolk they contain. Give examples of chordates that have the said type of egg. Isolecithal Telolecithal
