The difference in genome size between prokaryotes and multicellular eukaryotes are mostly due to The abundance of non-protein-coding DNA that includes regulatory DNA and DNA of unknown if any function The abundance of protein-coding DNA The abundance of tRNA genes Junk DNA, most common in prokaryotes, is the biggest factor

The difference in genome size between prokaryotes and multicellular eukaryotes are mostly due to The abundance of non-protein-coding DNA that includes regulatory DNA and DNA of unknown if any function The abundance of protein-coding DNA The abundance of tRNA genes Junk DNA, most common in prokaryotes, is the biggest factor

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letter
Genes participating in informational processessuch as replication, transcription, and translation aretransferred between species much less often than aregenes involved in metabolism. The basis for this inequalityis unclear at present, but one suggestion is that it relatesto the underlying complexity of the two types of processes.Informational processes tend to involve large aggregatesof different gene products, whereas metabolic reactionsare usually catalyzed by enzymes composed of a singleprotein. Why would the complexity of the underlying pro-cess—informational or metabolic—have any effect on therate of horizontal gene transfer?
Suppose you are a research assistant ina lab studying DNA-binding proteins. You have been giventhe amino acid sequences of all the proteins encoded bythe genome of a certain species and have been asked to findcandidate proteins that could bind DNA. What type of aminoacids would you expect to see in the DNA-binding regions ofsuch proteins? Explain your thinking.
The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find proteins thatinteract with any particular protein of interest. Theidea is to use the protein–protein interaction to bringtogether a DNA-binding region with an activation region, creating an artificial activator that consists oftwo polypeptides held together noncovalently by theinteraction.The method is called the yeast two-hybrid system,and it has three components. First, the yeast contains areporter gene construct in which UASG (an enhancerlike sequence that binds the activator Gal4 as describedin Problem 8) drives the expression of an E. coli lacZreporter (encoding the enzyme ß-galactosidase) from ayeast promoter. Second, the yeast also expresses a fusion protein in which the DNA-binding domain of Gal4is fused to the protein of interest; this fusion protein iscalled the bait. The third component is a cDNA librarymade in plasmids, where each cDNA is fused in frameto the activation domain of…
Since it was deciphered four decades ago, somehave claimed that the genetic code must be a frozen acci-dent, while others have argued that it was shaped by nat-ural selection. A striking feature of the genetic code is itsinherent resistance to the effects of mutation. For example,a change in the third position of a codon often specifies thesame amino acid or one with similar chemical properties.The natural code resists mutation more effectively (is lesssusceptible to error) than most other possible versions, asillustrated in Figure Q1–1. Only one in a million comput-er-generated “random” codes is more error-resistant thanthe natural genetic code. Does the extraordinary mutationresistance of the genetic code argue in favor of its origin asa frozen accident or as a result of natural selection? Explainyour reasoning.
Not all proteins are made from the RNA genome ofbacteriophage MS2 in the same amounts. Can you explainwhy? One of the proteins functions very much like a repressor,but it functions at the translational level. Which protein is itand how does it function?
The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower? GTGCATCTGACTCCTGAGGAGAAG САCGTAGAСTGAGGACTССТСТТС ... ... DNA ... ... (transcription) GUGCAUCUGACUCCUGAGGAGAAG RNA •.. ... (translation) VHLT PE K protein ... Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a UPPER b. LOWER
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
Iove aIung the HRNA from codon to codon, the appropriate amino acids are brought into place and linked together according to the sequence of codons. Thus, the code in the mRNA is translated into a special sequence of amino acids. The order of the amino acids in the protein, therefore, is specified by the MRNA, which in turn is transcribed from the DNA. Procedures and Observations: During transcription, the DNA double helix unwinds and "unzips. The two strands separate as the hydrogen bonds binding the nitrogen bases break. Then, nucleotides present in the cell line up along one strand of the DNA, the order of the nucleotides determined by the order of the nucleotides in the DNA. As the mRNA forms, uracil (U) nucleotides match with adenine (A) nucleotides; cytosine (C) nucleotides match with guanine (G) nucleotides. Note: RNA contains uracil (U) nucleotides where thymine (T) nucleotides would occur in DNA. The nucleotides in the newly formed mRNA are complementary to the nucleotides of…
The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…