The coding sequences of Gene F' and Gene G' are shown by the double-stranded DNA shown below: Gene F 5' ATGGGAGCACCAGGATAAGATGGATATCATTAG 3' 3' AGTTACCCTCGTGGTCCTATTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F' is transcribed. 2. Write down the polypeptide chain when Gene F' is completely expressed. 3. Write down the messenger RNA sequence when Gene G' is transcribed. 4. Write down the polypeptide chain when Gene G' is completely expressed.

Acute Haemorrhage

Mrs. J. is a 25-y/o gravida 2, para 1, who was admitted at full term at 5:00 p.m. She stated that she had been having contractions at 8 to 10 minute intervals since 4 p.m. They lasted 25 seconds. She also stated that she had been having "a lot of false labor" and this makes her still able to feed and able to maintain a conversation and is getting excited. But now she hoped that this was "the real thing". Her membranes were intact. Mrs. J.'s temperature, pulse and respirations were normal and her blood pressure was 115/70. The fetal heart tones were 140 and regular. The nurse examined Mrs. J. and found that the baby's head was at +1 station, and the cervix was 4 cm. dilated and 70 percent effaced.   As the labor progresses, there will be some discomforts Mrs. J will experience. By accomplishing the table below, you will be able to anticipate these discomforts then may be able to apply measures to alleviate or assist Mrs. J to have a safe delivery.

Anterior means

Should the physician supply enough medication to provide relief or only enough pills for the patient to take when she explained experiencing pain that she cannot absolutely bear?

в 4 D