The amount of NaCl in 10 mL of 1/4NS is 22.5 (Do not write the number, write the abbreviated unit.)

Q: Y-linked Inheritance. One trait that is Y-linked is hypertrichosis of the ears. Suppose a man with…

A: Sex linked inheritance is an inheritance pattern in which gene governing a particular trait is…

Q: Please answer fast List the steps of protein translation. Briefly summarize the mechanisms…

A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…

Q: Which group of the following is probably the least likely to have the harmful Tay Sachs alleles…

A: Tay Sachs disease or GM2 gangliosidosis occurs when a child inherits a  mutation in the HEXA gene…

Q: Enzymes involved in amplification of gene

A: Thermostable DNA polymerase is required for the amplification of the gene.

Q: Which is the best amino acid to hold a tyrosine in position at an active site? O serine O alanine O…

A: Simple organic compounds called amino acids are made up of a basic amino group, a special organic…

Q: My PDB code: 3GRS residue point: 66 (LYS) mutation: VAL

A: 3GRD.PDB is the crystallographic structure of GLUTATHIONE REDUCTASE solved at1.54 ANGSTROMS…

Q: I don't get it. I need help to explain to me

A: Mutation can be classified as small -scale or large- scale. In the concerned mutational phenomenon,…

Q: Question 5 To identify genes associated with the movement disorder Parkinson's disease, you decide…

A: Inorder to amplify a double stranded DNA via PCR, we require 2 sets of primer; a forward primer and…

Q: Justify. Peripheral protein is easiest to isolate and study.

A: Protein is a polymer formed from amino acid joined by peptide bond. The basic structure of the…

Q: Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the…

A: Alpha polypeptide (ADH1A)- Alcohol dehydrogenase 1A is a type of enzyme which in humans it is…

Q: Which of the following is the deadliest genotype for the Tay Sachs allele? O t O Tt O TT

A: Tay-Sachs disease or TSD is a lysosomal storage disorder. The cause of this disorder is a mutation…

Q: W) Plot the "specific fluorescence” against time in a graph, and comment on the result.

A: Fluorescence is the phenomenon of emission of specific wavelengths of light by any fluorescent…

Q: Which of the following best represents the amino acid sequence found in normal adults with the HBB…

A: The Hemoglobin beta chain gene consists of code for 146 aminoacid sequences, where each amino acid…

Q: Using an appropriate example, explain why changes in proteinstructure can be dangerous.

A: The proteins are one of the important bio-molecules which play many important roles in an organism.…

Q: describe the path of a protein as it travels through the endomembrane system of a eukarvotic cell

A: An Eukaryotic cell has membrane bound nucleus and membrane bound cell organelles such as…

Q: Please use the following terms and describe how each works to control protein expression. -…

A: The process in which the DNA is trans formed into an mRNA is known as the process of transcription.…

Q: The standard notation for describing the common mutation in the HBB gene that, when homozygous,…

A: Sickle cell anemia is an inherited disorder which affects the formation of hemoglobin and disrupts…

Q: Y. A patient weighing 70 kg has an insulin drip with 100 unit of regular insulin in 250 mL normal…

A: Drug Calculations are an essential part of critical care nursing. We as Nurses need to administer…

Q: Not make to copy or incorrectly do. Else downvote.

A: We know that Genotype is defined as the genetic makeup of an individual organism and it is the sum…

Q: pand ELISA. Write one application.

A: Immunology refers to the body's physical, chemical, and biological responses to external substances.…

Q: The ability to roll your tongue. What are the roles of the DNA, genes, and proteins in a given…

A: The term tongue-rolling refers to twisting, rotating, folding, adjusting, and turning off the…

Q: True or False: There is more than one place on the bacterial ribosome that can be targeted for drug…

A: Ribosomes are cellular organelles found in all living cells, including bacteria, archaea, and…

Q: Please ASAP. Thank you. The endosymbiosis theory states that the DNA in chloroplasts and…

A: The theory states how does the eukaryote evolve from prokaryotes. The theory supports evolution.

Q: Discuss how the cell uses RNA molecules to synthesize proteins.

A: The majority of living things and viruses include the molecule known as ribonucleic acid (RNA). It…

Q: : RNA polymerase is capable of binding directly to the promotor site if any gene

A: The RNA polymerase and the necessary transcription factors bind to the promoter region and initiate…

Q: Please Answer ASAP. Thank u. Genetically modified plants resistant to the herbicide glyphosphate…

A: Genetic modification is a technique in which a desired stretch of DNA (gene of interest) is inserted…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: The mRNA is produced by the process of transcription. It takes place in the nucleus. The RNA…

Q: True or False: When determining the transcription start site, there is a nucleotide position…

A: Question - True or False : When determining the transcription start site , there is a nucleotide…

Q: Need Help. Describe some genetic disorders caused by chromosomal abnormalities (e.g.,…

A: A genetic disorder is a health problem caused by one or more abnormalities in the genome. It can be…

Q: Under normal conditions, an mRNA molecule that is 99 bases long will create a protein composed of: -…

A: Note: According to bartleby guidelines only first three subparts are to be answered. So please…

Q: Each gene codes for just one protein.

A: The portion of the genome that codes for a protein or an RNA is referred to as a gene. The genes…

Q: 1. Make a frequency distribution table. Step 1: Arrange 79 84 89 93 80 77 83 89 79 84 76 76 75 80 67…

A: The frequency of an observed value refers to the number of times that specific value is repeating in…

Q: Suppose an X-linked gene in mice exists as two alleles, B and b. X-chromosome inactivation, a…

A: Northern blotting is a technique in the molecular biology to study the gene expression. It is used…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: Describe either 1) how you would go about making a goat that produces a silk protein (S) in it's…

A: "Transgenic" is an alternative term used for "genetically modified organisms", these are those…

Q: POST-ACTIVITY SKIL 1. The E2F family of transcription factors is important in regulating the cell…

A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…

Q: Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the…

A: Sickle-cell anemia is a genetic disease characterized by the sickle shape of the RBCs. It results in…

Q: Part I. First, you want to characterize the basic structure of the Super_Toxic1 gene. Identify the…

A: During transcription, the template strand of DNA is transcribed into a mRNA. This process requires…

Q: What is the typical result of conjugation between one FT cell and one F cell? a. one Hfr cell and…

A: It is the process by which one bacterium transfers genetic material to another through direct…

Q: lactose intolerance is genetically transmitted from parent to offspring

A: lactose intolerance is problem in which people suffering from this condition not able to digest…

Q: Communications between cells is facilitated by the presence of

A: There are many cells in our body. Each cell needs to communicate with the other. This means the…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other…

A: Hi! As you have posted multiple questions, I will be answering the first question for you. If you…

Q: Genetic manipulation causing expression of a particular gene in an organism that normally does not…

A: