Ten students have applied for ten fellowship positions in ten schools. The students have submitted their ten preferences (table B) The schools have also had their list of preferences (table A). The task is to write an algorithm to find the best matching of student-school pairs. 1. Algorithm 2. The matching 3. The algorithm analysis (in terms of big O) Full explain this question and text typing work only We should answer our question within 2 hours takes more time then we will reduce Rating Dont ignore this line

Ten students have applied for ten fellowship positions in ten schools. The students have submitted their ten preferences (table B) The schools have also had their list of preferences (table A). The task is to write an algorithm to find the best matching of student-school pairs. 1. Algorithm 2. The matching 3. The algorithm analysis (in terms of big O) Full explain this question and text typing work only We should answer our question within 2 hours takes more time then we will reduce Rating Dont ignore this line

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter4: Selection Structures

Section: Chapter Questions

Problem 14PP

See similar textbooks

Similar questions

Question-1 Friend's Party Circle: There are a few friends living in the same area. They have a party every weekend and the place of party change each week. It is always a lifficult task to select a place which is nearest for everyone. They advantage of Computer Science to solve this problem. all decided to take Names of friends are Ahmed, Rehman, Careem, Basit, Dawood, Ghani, and Farid. Ahmed lives at 5 minutes' walk from rehman and at 10 minutes' walk from Careem. Careem lives at 3 minutes' walk from Dawood. Rehman lives at 4 minutes' walk from Basit and 2 minutes' walk from Dawood. Dawood lives at two minutes' walk from Farid. Ghani lives at 2 minutes' walk from Basit. a. If we represent a graph G = V (V, E) in which set of vertices are home of each Friend and an edge represents a path between two homes. Provide the adjacency matrix of directed graph of the graph G. b. In above directed graph G. You are required to devise an algorithm to find all possible paths.
ANALYSIS & DESIGN OF ALGORITHMS subject Three points P, Q, and R are said to be collinear if they are on a single line. To check whether the 3 points lie on the same line, we use the distance formula. If P, Q and R are three collinear points, then: Distance from P to Q + Distance from Q to R = Distance from P to R PQ + QR = PR The distance between two points (x1, y1) and (x2, y2) is given by Hence, we can easily find the distance between the points P, Q and R, with the help of this formula. Design an algorithm (pseudocode) to check whether three points are collinear. In your solution include the input and the output.
Correct answer will be appreciated else downvoted multiple times
Transcribed Image Text A student took four quizzes in a term and would like to compute their average. He also would like to know what will be the remarks. Follow the range of grades and its equivalent remarks, and then fill-up the table below: 100-95 - Excellent 94-90 – Very Satisfactory 89-85 - Satisfactory 84-80 - Fine 79-75 - Fair 74 and below - Poor
Correct answer will be upvoted else Multiple Downvoted. Don't submit random answer. Computer science. anglers have recently gotten back from a fishing excursion. The I-th angler has gotten a fish of weight man-made intelligence. Anglers will flaunt the fish they got to one another. To do as such, they initially pick a request where they show their fish (every angler shows his fish precisely once, in this way, officially, the request for showing fish is a stage of integers from 1 to n). Then, at that point, they show the fish they discovered by the picked request. At the point when an angler shows his fish, he may either become glad, become dismal, or stay content. Assume an angler shows a fish of weight x, and the most extreme load of a formerly shown fish is y (y=0 if that angler is quick to show his fish). Then, at that point: in the event that x≥2y, the angler becomes cheerful; in the event that 2x≤y, the angler becomes miserable; in the event that none of these two…
For the following problem please write an algorithm in plain English .i.e give details as to how you will solve the problem.A deck of 52 playing cards (as used for playing bridge) has to be sorted. At the end of the attempt, the sorted deck of cards should be on the table with the backside up.The order within a suite is Ace - King - Queen - Jack- 10 -9 - 8 - 7- 6- 5- 4- 3- 2. The very first card in the sorted deck is the Ace of Clubs, the next ones are the King of Clubs, the Queen of Clubs, the Jack of Clubs, the 10 of Clubs ... down to the 2 of Clubs. The next card is Ace of Spades, followed by the King of Spades etc. The hearts and diamonds cards follow in the same order.The deck of cards must be well-shuffled immediately prior to the challenge.Please write the algorithm in steps like you write a recipe for a dish.If any steps need to be repeated try to use a loop.Please try to not use any programming language.(IT's one question just with a lot of instructions to be understood well)
Which design strategy does the following solution use? Celebrity problem A celebrity among a group of n people is a person who knows nobody but is known by everybody else. The task is to identify a celebrity by only asking questions to people of the form: "Do you know him/her?" Solution Select two people from the group given, say, A and B, and ask A whether A knows B. If A knows B, remove A from the remaining people who can be a celebrity; if A doesn't know B, remove B from this group. Solve the problem recursively for the remaining group of people who can be a celebrity.
Which design strategy does the following solution use? Celebrity problem A celebrity among a group of n people is a person who knows nobody but is known by everybody else. The task is to identify a celebrity by only asking questions to people of the form: "Do you know him/her?" Solution Select two people from the group given, say, A and B, and ask A whether A knows B. If A knows B, remove A from the remaining people who can be a celebrity; if A doesn't know B, remove B from this group. Solve the problem recursively for the remaining group of people who can be a celebrity. zi tuo) Variable-size-decrease algorithm Divide-and-Conquer Decrease-by-a-constant factor algorithm Decrease-by-a-constant algorithm
Write an algorithm to calculate the average age of students in the class (x), where(y) represents the age of the student
Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACT
Only correct answer will be appreciated else downvoted.
Personal project Q5. This question is concerned with the design and analysis of recursive algorithms. You are given a problem statement as shown below. This problem is concerned with performing calculations on a sequence A of real numbers. Whilst this could be done using a conventional loop-based approach, your answer must be developed using a recursive algorithm. No marks will be given if your answer uses loops. FindAverageAndProduct(a1, ...., an) such that n > 1 Input: A sequence of real values A = (a1, ...., an) Output:, A 2-tuple (average, product) containing the average (average) of all the values and the product (product) of all the values of the elements in A. Your recursive algorithm should use a single recursive structure to find the average and product values, and should not use two separate instances of a recursive design. You should not employ any global variables. (a) Produce a pseudo code design for a recursive algorithm to solve this problem. (b) Draw a call-stack…