Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
The following is the partial sequence of a bacterial gene ORF: 5’ --------------------CGGAATTCCCGGGGATCC------------------------3’ (The remaining sequence of the gene ORF never affects the cloning of this gene. The multiple cloning sites of the plasmid vector can be cleaved by 8 restriction endonucleases that are listed in the table.
5’- and 3’-end sequences of the bacterial gene ORF are 5’ ATGGAGT TATCCAGGTGCCT--- and 3’AATATGGAGTTATCCAGGTGCCT---, respectively. After choosing the appropriate restriction endonuclease(s) for directional cloning using the table below, determine the sequences of two 20-mer primers used for the PCR amplification of the gene ORF.
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps
Knowledge Booster
Similar questions
- Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHIarrow_forwardSynthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?arrow_forwardA amp PBR322 4301 fot B Clear Zones Figure 2 The postgraduate student, Demika, inserted her gene of interest into the plasmid, pBR322, before transformation into the competent host cell using heat shock method. After that she cultured the cells on the Ampicillin agar plate before replica plating the colonies onto another Ampicillin (A) and Tetracycline (B) agar plates shown in Figure 2. (1) Referring to the vector pBR322 in Figure 2, which recognition site was cleaved to insert the gene of interest? Based on the observation above, can you identify which colonies are carrying positive mcombinants of BR322? Explain your selection.arrow_forward
- Create the restriction map for the plasmid below:arrow_forwardA cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHIarrow_forwardUse the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. What is the smallest fragment size that the NcoI/EcoRI double digest produces?arrow_forward
- Use the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. IF the EcoRI/BamHI double digest produces 3 fragments with only two sizes, what are their sizes?arrow_forwardAfter cloning, they transformed and plate bacterial cells using their cloned plasmid. Onto what type of growth medium will they plate their cells in order to distinguish between bacterial cells that obtained the plasmid and those that did not?arrow_forwardThe DNA polymerase used in PCR is taken from Thermus aquaticus, a bacterium that thrives in the extremely high temperatures of hot springs. Why is it necessary to use special DNA polymerase? * bers erences QOnline Thermus aquaticus is accustomed to efficient replication. wsela Thermus aquaticus can survive at boiling and freezing temperatures, both of which are necessary during PCR. ation ogy Periods 1 and 2 "Normal" DNA polymerase would denature in the high temperatures used in PCR. ng periods chool MP1, Highschool Highschool MP3, school MP4 Thermus aquaticus is able to supply a varied amount of bases to the DNA template. tion ting days n Tue Wed Thu Fri Mutations occur randomly during the process of gene expression or by exposure to mutagens. While some mutations are detrimental, others can create proteins that ha n nociti e conahilition In vder fo ra mutation te be n esed tn futuen INTLarrow_forward
- See imagearrow_forwardUse the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. What is the largest fragment size that the BamHI/NcoI double digest produces? 2.250 kb 2.500 kb 2kb 750 barrow_forwardIn Figure 5-19, how many different bacterial species areshown as having contributed DNA to the plasmid pk214?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education