Suppose you had isolated a new transcription factor and wanted to know which genes this proteinmight regulate. Is there any way that you could use a cDNA microarray of the type shown in the pictureto approach this question? Yeast cells growing inglucose-rich mediumYeast cells growing inethanolrich mediumlacking glucoseExtract andExtract andpurify MRNASpurify MRNASMRNASMRNASSynthesize CDNAScontaining greenfuorescent dyeCy3Synthesize CDNAScontaining redluorescent dyeCy5(b)GlucoseCDNASCDNASCell densityMix two CDNA populationsEthanolIncubatemicroarraywith mixedDNApopulation+0 d5 d10 d15 c00000000loo000000000000.loo00000000000000b00000O.lo0000000000000O.(c)CIT1ACO1IDH1IDH2KGD1KGD2LSC1LSC2|SDH1SDH2SDH3SDH4FUM1MDH1Completed DNA microarray-Application of DNAspot onto slideSpot DNA fromeach well onto slideDNA clones(each well contains adifferent yeast gene)(a)>16X| >16Xinducedrepressed(d)

Name: Suppose you had isolated a new transcription factor and wanted to know
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Suppose you had isolated a new transcription factor and wanted to know which genes this proteinmight regulate. Is there any way that you could use a cDNA microarray of the type shown in the pictureto approach this question? Yeast cells growing ingluc

Microarray : is a laboratory technique used to simultaneously measure the expression of thousands of…

Science

Biology

Suppose you had isolated a new transcription factor and wanted to know which genes this protein might regulate. Is there any way that you could use a cDNA microarray of the type shown in the picture to approach this question?

Suppose you had isolated a new transcription factor and wanted to know which genes this protein might regulate. Is there any way that you could use a cDNA microarray of the type shown in the picture to approach this question?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’
Give only typing answer with explanation and conclusion The Shine-Dalgarno sequence (or Shine-Dalgarno box), is a conserved sequence in the mRNA, generally located 8 base pairs upstream of the start codon AUG. The complementary sequence (CCUCCU), is called the anti- Shine-Dalgarno sequence and is located in another cellular nucleic acid. Which one? The antisense strand of DNA of the translated gene The 23S rRNA The fMet-tRNA The 5S rRNA The 16S rRNA
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
Cytosine deaminationoccurs ~100 cytosinesper genome per day in a human genome. Eukaryotic cells also contain residues of 5’-methylcytosine, which is involved in regulating gene transcription rates. Mutation of 5’-methylcytosine by deaminationconverts it to thymine. This presents the cell with a much more severe problem than normal cytosine deaminationof cytosine to uracil. Why?
Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker Carol to be messengers, while their boss can't leave the nucleus. Paramecium Parlor I'm telling you, Carol I'm DONE being this guy's messenger boy Bod Moeba Sreters He can leave the (nucleus and do it himself for all I carel Arthur, the mRNA, was at the end of his strand at work.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
Quick activity Use the genetic code to translate the following 30 nt mRNA sequence: AUGAUCCUAGGGUGCAUGAUGCCAAAAUAA Prezi 1st letter UUU Phe UCU U UUC JUA UUG U CUA CUG Leu AUU A AUC lle AUA CUU CCU C CUC Leu CCC Pro CCA CCG UAU UCC Ser UAC UCA UAA UCG UAG ACU ACC Second Letter ACA AUG Met ACG C GUU GCU G GUC Val GCC GUA GCA GUG GCG AAU Thr AAC AAA AAG Ala CAU His CAC CAA Gin CAG GAU GAC A GAA GAG Tyr UGU Cys U UGC Stop UGA Stop Stop UGG Trp CGU CGC Arg CGA CGG Asn Lys Glu G AGA AGG Asp GGU Arg DCAG DCA AGU Ser U letter AGC GGC Gly GGA GGG A U VAG U JOJO 3rd G Alb
8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…
me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…
In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3’ 3' AGTACTCTAT CGGTACGTAT AGATCTATCA TCCGTAGACT CAAATATAGA GT 5'