Q: Explain why a good, healthy growth of bacteria in broth can clear, as if by magic, and all the…
A: The cycle of infection is a model that describes how the host-pathogen interactions change during…
Q: Symbiotic Relationship Define in Your Own Illustrate a Way to Remembe Words
A: Answer. Parasitism Parasitism is a relationship between two organisms in which one species…
Q: Diff erentiate among the diff erent portals of entry, and give examples of pathogens that invade by…
A: There are several portals of entry and modes of transmission which is achieved by various microbes.…
Q: Which of the following statements regarding the transmission of pathogens from environmental…
A: Asepsis: It can prevent the rate of nosocomial infections. Principles of asepsis Hand hygiene. Safe…
Q: A(n) _______ organism is part of the normal microbial flora of the host A. Acquired B.…
A: The microorganisms are responsible for development of particular disease. But not all microorganisms…
Q: MRSA are resistant to because they have a
A: The compounds produced by microorganisms or their derivatives which can kill or inhibit the growth…
Q: Pathogens must enter host cells to cause disease. Explain why or why not.
A: A pathogen can be defined as the organism which has the potential to cause disease to other…
Q: When comparing S. aureus and S. epidermidis, which organism contains more virulence factors? S.…
A: Since you have posted multiple questions, we will solve the first question for you. If you want any…
Q: Describe the factors that affect virulence/ pathogenicity
A: A microbe that is capable of causing disease is referred to as a pathogen. Pathogenicity is the…
Q: ...means degrading/removing environmental poisons or pollutants by microorganisms such as fungi
A: Bioremediation
Q: A term to describe physical treatments that kill microbes on items or surfaces would be…
A: Microbes are microorganisms that make up a large fraction of the atmosphere. They are present…
Q: A pathogen would most accurately be described as aa. parasite.b. commensal.c. saprobe.d. symbiont.
A: Step 1 The disease is a disorder or deranged functioning of the body that results from an infection,…
Q: Draw and briefly explain various stages in parasitism. Draw diagrams on page.
A: In parasitism, a particular organism resides within the body or the surface of another organism…
Q: Select the letter of the choice that best completes the statement. Using clean linens and equipment…
A: The entry of any pathogen or microbe into the body and start affecting the normal metabolism of the…
Q: Define the following terms and give one example for each: (a) Commensalism (b) Parasitism (c)…
A: Commensalism- it is a relationship between individuals of two species in which one species obtains…
Q: Bacterial capsules work by _____. View Available Hint(s) for Part E protecting the bacterium…
A: So correct option will be protecting the bacterium from engulfment Capsules made of substances…
Q: Give ten examples of signs of pathogens. Remember these are structures of the pathogen that you see…
A: Immune system of the body forms the defence mechanism for us which fights infectious and…
Q: Explain the difference between an infection caused by a fungus and an allergy caused by a fungus. An…
A: infection is a pathological state in the body in which the infected part of the body behave slightly…
Q: The yeast Candida albicans does not normally cause disease in a female's vagina because its growth…
A: Q. The yeast Candida albicans does not normally cause disease in a female's vagina because its…
Q: Commensalism can be a form of parasitism. Explain why and cite an example.
A: In an ecosystem, the interaction between individuals of varying species can occur. It could be…
Q: List three potential fomites that you contacted today.
A: Fomites are non-living objects contaminated with a pathogen. When fomites come in contact with a…
Q: something that is easily spread from one host to another a pathogenic microbe an abnormal state in…
A: healthy body is considered to be that body that does not have any form of aberration in the…
Q: Tolerance to nitrate therapy is common. Provide strategies to prevent nitrate tolerance.
A: The majority of the treatment procedure entails the administration of medications or…
Q: Select a pandemic. Outline the process involved in the occurrence of the selected phenomenon.
A: Pandemics in the condition when a disease occurs at the same time worldwide or in a very large…
Q: foodborne pathogens associated with: 1. shrimp 2. coconut water 3. green chili
A: Food borne pathogens are pathogens like the bacteria , viruses and protozoans present in the food…
Q: Plant pathogens strategies varies when it comes to damage their respective host. Justified the above…
A: Plant pathogens are the organisms, such as fungi, bacteria, protists, nematodes, and viruses that…
Q: Pathogens can live on surfaces for quiet some time. What can you do to prevent transmissions from…
A: The pathogens are microorganisms like bacteria and virus that has the potential to cause various…
Q: Nicotine is a toxin in tobacco associated with “antibiosis” type of host plant resistance.
A: For more than 350 million years, plants and insects have coexisted. Both have evolved techniques to…
Q: Which best represents a chemical mediator that inhibits pathogen invasion? keratin antibacterial…
A: There are various chemical barriers against infection causing agents such as bacteria. Enzymes in…
Q: Give a disease-causing pathogen or microbe and answer the following questions.
A: Introduction :- A pathogen is a disease-causing organism. Microbes are found in abundance in your…
Q: Define the basic reproduction number for a pathogen.
A: Reproduction is a process of production of new individuals or offspring by the parents. The process…
Q: Once these pathogens enter the host the difference in environmental conditions signals for them to…
A: Disease causing organisms are known as pathogens. Different types of pathogens have different modes…
Q: The is the time that lapses between encounter with a pathogenand the first symptoms.a. prodrome b.…
A: Pathogen A pathogen is a foreign particle that can invade a host body and can cause infections. The…
Q: When a child skins their knee and neosporin is applied, this reduces the chances of pathogens…
A: Pathogens are the organisms which upon entering in to the host causes infectious diseases.…
Q: Indicate which response would be most important for each pathogen attack. A fungus that can attack…
A: Hypersensitive response- It is a mechanism used by the plants to prevent the spread of infection by…
Q: If an antimicrobial drug does not exhibit selective toxicity, what might be a problem experienced by…
A: Antimicrobials These are the drugs used to kill the microbes causing some pathogenesis in the human…
Q: Match the description to the specific type of symbiosis.
A: Ans 73. Ecological cooperation between two or more organisms, each having a net profit, is…
Q: Most Bacillus species area. true pathogens b. opportunistic pathogens c. nonpathogens d. commensals
A: Bacteria are the large domain of the prokaryotic organisms. They are classified based on the number…
Q: respond to at least one of your peers about different methods that can be used to decontaminate…
A: Decontamination is important to health and safety at hazardous waste facilities because it removes…
Q: Explain how the host responds to the infection of pathogens.
A: Answer :- There are several ways tothe host responds to the infection of pathogens are as follow :-…
Q: Suppose that during a heart operation, a bacterial infection was inadvertently transmitted to the…
A: Infection - It is the invasion of an organism's body tissues by disease-causing agents such as…
Q: The deadliest microbial toxins are those that target the Immune system (superantigens) O Digestive…
A: Introduction Toxins Produced By Microorganisms, Such As Bacteria And Fungi, Are Known As Microbial…
Q: The term "Microbial antagonism" describes the process by which: O A) Opportunistic pathogens cause…
A: Antibiotics are the medicines which are used to cure infections which are caused by bacteria. These…
Q: Choose the combination of answers that most accurately completes the statement. ................ is…
A: Introduction Hormones regulate various physiological activities of the body such as growth,…
Q: rganism saccharomyces and Candida albicans mode of transmission, Disease if any and location in host
A: Micro-organism are tiny organisms that cannot be seen by the naked eye, but are visible under…
Q: Pick one foodborne pathogen/illness and describe the organism that is associated with this foodborne…
A: The foodborne disease discussed here will be typhoid.
Q: testing fungal effectors for their ability to either promote or block a
A: Effectors either induce the virulence of fungi that are pathogenic or allow symbionts to associate…
Q: Justify this statement: "Botulism is not an infection". Use the pathogenicity mechanism to guide…
A: Botulism is poisoning that occur without infection if the Clostridium botulinum toxin is ingested,…
Q: Choose a viral pathogen and briefly describe how it performs the following in human hosts: •…
A: Virus They are the submicroscopic infectious agents that only able to replicate inside it's host.
Q: Explain how two virulence factors work.
A: Since you have posted multiple questions we solve the first question for you. To get the remaining…
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Statement regarding the transmission of pathogens from environmental surfacesExplain why these body temperature phases typically happen in malaria patients.Use the following formula to explain the relationships among theseveral factors and what happens when they change:Infection (infectious disease) = No. of organisms × Virulence _____________________________________ Host resistance
- Match the periods of disease with their characteristics: incubation period prodomal period period of illness period of decline period of convalenscence Word bank - pathogen begins to decline in number and symptoms begin to abate - signs and symptoms of illness are obvious and severe - initial signs and symptoms of illness begin to present - host recovers and returns to a general state of health - pathogen begins to establish itself in the host, but no signs or symptoms are presentThis is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acidsIndicate which response would be most important for each pathogen attack. A fungus that can attack the roots, leaves, stems, and flowers of a plant Systemic acquired resistance Hypersensitive response A small colony of protists infects a leaf A localized bacterial infection in a single leaf After an initial pathogen attack, a second pathogen attacks several weeks later
- Explain the role of microbial antagonism in normal health of an individual. Use ALL of the following words in your explanation, and highlight each word with a highlighter: niche, microbial antagonism, compete, and commensal.A term to describe physical treatments that kill microbes on items or surfaces would be Microbiocentric Microbiocidal Microbicycle MicrobiostaticParasitism Mutualism O Commensalism Clear selection In Africa there exists an unusual relationship between ants and the Acacia tree. The tree sap provides food for the ants, and the ants protect the tree from predators. O Parasitism O Mutualism O Commensalism Athlete's foot is caused by a fungus that grows on the warm moist skin of the people, often around the toes of the feet. It may cause severe itching and
- Please provide an example of a water-borne pathogen. Please provide the genus and species of the pathogen, along with the name of the illness the pathogen causes in humans.Which best represents a chemical mediator that inhibits pathogen invasion?keratin antibacterial soap resident microbiota serum sebum ciliaPathogens can live on surfaces for quiet some time. What can you do to prevent transmissions from surface to body?