Question 11 Chordates typically have O a notochord. O radialcleavage. All of the choices are typical chordate features. O a coelom that iseither enterocoelous or schizocoelous. O the anus derivedfrom the blastopore.

Q: Enables you to abduct and raise your arm at the shoulder joint? ___________________________

A: Question - Enables you to abduct and raise your arm at the shoulder joint?…

Q: Define dislocation

A: Introduction: Anatomy is that branch of medical science that describes the location and structure of…

Q: What is the procedure of sit and reach? What are the equipment will be used?

A: The sit and reach test (SR test) is a muscle function test developed by Wells and Dillon in 1952…

Q: Question:Muscle or muscles that answers the question:If the triceps brachii is a prime mover of…

A: Antagonist is a muscle with the opposite action of the prime mover. There are two important…

Q: At initial contact, the ankle should be Dorsiflexed Select one: True False

A: Bones make form the skeleton. Different types of bones are connected to one another in a certain…

Q: _________ unwinds DNA.

A: DNA is the genetic material which is formed by the polymerization of nucleotides. DNA Store the…

Q: nter your answers in the spaces provided.

A: Muscle fibres are specialised cells that make up the muscular system. its ability to contract is its…

Q: Rotator Cuff Muscle Action   Supraspinatus     Infraspinatus     Teres minor…

A: The shoulders in the chest, back, and upper arms are moved by the muscles. The scapula and humerus…

Q: MARK and Identify the insertion of the Extensor carpi ulnaris on the image below

A: Extensor carpi ulnaris It is defined as a fusiform muscle that is present in the posterior forearm.…

Q: QUESTION 9 Identify the insertion of the Extensor carpi radialis longus on the image below…

A: The soft tissue in mammals is muscle. The muscle cells possess protein filaments, namely, myosin and…

Q: Is the length of muscle contraction at the beginning of tetanic contraction the same or different…

A: A tetanic contraction can be defined as a sustained muscle contraction that evokes when the motor…

Q: 61. Identify the muscle indicated by tag #61. 61 61

A: Pulmonary means relating to the lungs or lung tissue. Pulmonary ventilation is also called as…

Q: A B F L D E I G H J K L M N (a) Sagittal section through the right knee joint

A: Joints are the structure in which two bones are connected with each other . Joints are classified…

Q: If a muscle has the word hallucis in its name, it must cause movement of the -…

A: Muscles are the part of skeletal system in animals and humans. Muscle tissue is made up of Myocytes…

Q: Define treppe

A: The filaments of myofibrils are known as myofilaments. These are principally composed of proteins…

Q: 67. Identify the three muscles that share the origin indicated by tag #67. Be specific 67

A: Hip Bone  It is formed by the attachment of 3 bones -  Ilium  Ischium  Pubis  It is also termed as…

Q: At initial contact, the ankle should be Dorsiflexed Select one: True False

A: Dorsiflexion can be referred to as the raising of the foot in the upward direction. In other words,…

Q: C Caudal Crania

A: Anatomy  A field of biology which deals with the structure of the organ and their part of a…

Q: Stem cell for Rheumatoid arthritis treatment Mesenchymal Stem/Stromal Cells for Rheumatoid Arthritis…

A: Introduction  The autoimmune illness rheumatoid arthritis (RA) affects the joints, producing…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: QUESTION 3 Normal bony limitation of elbow flexion is limited by the coronoid process fitting into…

A: Answer- Tuberosity of ulna

Q: Why is it more difficult for Eric to lift a heavy weight when hisforearm is pronated than when it is…

A: The up and down orientation of the body parts such as hand, arm and foot are mentioned with the…

Q: 62. Identify the muscle indicated by tag #62. 63. Identify the muscle indicated by tag #63. 64.…

A: 62.  Figure is Medial view lower limb showing medial thigh muscles . Muscle indicated by #62 :…

Q: The detachment of the cross-bridge during muscle contraction occurs when __________________

A: Introduction: ATP supplies the energy necessary for the contraction of muscles. It is vital in the…

Q: QUESTION 15 Identify the origin of the highlighted muscle: A. Head and shaft of Fibula and Posterior…

A: Legs generally have long muscles. The muscles in the leg are highly stretchable. The contraction and…

Q: Which number is triceps brachii

A: Locomotion and movement of our body are carried out with the help of muscles and bones. Muscles…

Q: Select the best answer or answers from the choices given: The arrangement of muscle fibers in which…

A: At the most basic level, all organisms are made up of cells. In multicellular organisms, these cells…

Q: MARK and Identify the origin of the Extensor carpi ulnaris on the image below

A: Extensor carpi ulnaris It is defined as a fusiform muscle that is present in the posterior forearm.…

Q: What is the neuromuscularsynapse?

A: The neuromuscular junction is a site where, the axons and the muscle fibers communicate with each…

Q: 59. Identify the muscle indicated by tag #59. 60. Identify two action(s) of the muscle indicated by…

A: Muscles are the soft tissue present in many animals. It consists myosin and actin protein filaments…

Q: If a prime mover muscle such as the pectoralis major is surgically removed, how will the actions…

A: Pectoralis major is a muscle located at the chest of the body of humans. It is a fan-shaped thick…

Q: quizzes/47131/take uestion 10 synergist muscle always aids the antagonist O True O False uestion 11

A: Movement by the body parts is made by the muscles present in them. In an alternating contraction…

Q: The muscle that oppose the action nover muscle is called: *

A: The muscular system is primarily responsible for creating motion via muscle contraction. Tendons are…

Q: The _________________________________________ muscle spans from the ribs and sternum to the pubic…

A: The abdominal wall surrounds the abdominal depression, giving it adaptable inclusion and ensuring…

Q: can someone help me identify what each of the numbers are labeled as? specifically anything that is…

A: "The description portion has been omitted since it would be impossible to adequately describe all…

Q: For this set of questions you will need to stand up from the chair you are sitting in, and then sit…

A: The skeletal system of the body consists of bones and joints.The bones of the skeletal system…

Q: The agonist for arm abduction at the should joint is the 1. brachialis 2. deltoid 3. pectoralis…

A: The proximal attachment point of a muscle is referred to as its origin. The distal attachment point…

Q: QUESTION 37 The latissimus dorsi adducts the shoulder while the deltoid abducts the shoulder. Which…

A: Muscles are connected with bones by tendons which is made of collagen tissue that can withstand the…

Q: Question 29 Identify two actions of the muscle indicated by tag #70. 70

A: The study which describes the shape, size, position of different organs, muscles, bones, vessels,…

Q: The inner thigh relative to the outer thigh would be:

A: The thigh bears much of the load of the body’s weight when a person is upright. It contains many…

Q: Inside view of edge. Note hacklemarks.

A: Tissue Response to Mechanical Stress1. Microtrauma and Microfractures:• Similar to hackle marks in…

Q: A С B D

A: The skeletal muscles are the type of muscles that are attached to the bone; when they contract, they…

Q: 49. Identify the muscle indicated by tag #49. 50. Identify the three actions of the muscle indicated…

A: The pectoral region is located on the anterior chest wall.  Four muscles are present on the anterior…

Q: The pectoralis minor is labeled B. C A D E

A: The given image shows the ventral muscles of the upper body. The pectoralis minor muscle is one of…

Q: Describe the condition frozen shoulder

A: Synovial joints join the bones with a joint capsule, and the joint cavity is filled with synovial…

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.